ID: 927218286

View in Genome Browser
Species Human (GRCh38)
Location 2:20682584-20682606
Sequence CCTCCCTGGCAAAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927218278_927218286 22 Left 927218278 2:20682539-20682561 CCAAGATTGAGGGGCTGGCATCT 0: 7
1: 24
2: 73
3: 216
4: 524
Right 927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 30
4: 227
927218281_927218286 -9 Left 927218281 2:20682570-20682592 CCTTTGTGCTACATCCTCCCTGG 0: 1
1: 0
2: 2
3: 18
4: 271
Right 927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 30
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927218286 Original CRISPR CCTCCCTGGCAAAAGGTGGA AGG Intergenic
902399549 1:16150553-16150575 CTTCCCTCCCAAGAGGTGGATGG + Intronic
902826270 1:18976452-18976474 AATCCCAGGCAAAAGGTGGAAGG + Intergenic
903606573 1:24579162-24579184 GCTTCCTGGGAAAAGGTGCATGG + Intronic
903692287 1:25183162-25183184 CCTCCCTGGTAAGTGGTTGAAGG - Intergenic
903965844 1:27088917-27088939 CTTCCCTGGCAAGCTGTGGAGGG + Intergenic
907053539 1:51345179-51345201 CCTCCCTGCCCCAAAGTGGAAGG + Intergenic
907418335 1:54329791-54329813 CCTCCCTGAGAAATGGGGGAGGG + Intronic
910333312 1:86100709-86100731 CCTCCCTGGCAGAGGGGGTAGGG - Intronic
911115890 1:94246866-94246888 CATGGCTGGGAAAAGGTGGAAGG + Intronic
913674446 1:121128102-121128124 CTTGCCTGGGAAAAGCTGGAAGG - Intergenic
914026231 1:143915411-143915433 CTTGCCTGGGAAAAGCTGGAAGG - Intergenic
914664668 1:149823164-149823186 CTTGCCTGGGAAAAGCTGGAAGG - Intergenic
917172214 1:172189776-172189798 CCACCATGGCAGAAGGTGAAAGG + Intronic
919455292 1:197813912-197813934 CCTCCCTGGTAAGAGGTTGTGGG + Intergenic
920635262 1:207696052-207696074 CCTCCCTAGCAATAGGACGAAGG + Intronic
921808399 1:219481697-219481719 CCTACCTGGAAGAAGGGGGAAGG - Intergenic
921954455 1:220967591-220967613 ACTCCCTGGCAAAGGGTGACTGG + Intergenic
922688159 1:227664218-227664240 CCTCCCTGGCTGAAGGTCTATGG - Intronic
923041933 1:230325783-230325805 CCAGCCTGGCAGAAGGGGGAGGG - Intronic
923545925 1:234923254-234923276 CCTCTCAGGGAAAAGGTGGGGGG - Intergenic
1063181126 10:3601426-3601448 CCTCTCATGGAAAAGGTGGAAGG + Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1066060910 10:31722843-31722865 CCTCCCTGGCAAAAGGGCGATGG - Intergenic
1067229116 10:44394764-44394786 CCTCACTGGCGAAATGGGGATGG - Intergenic
1069621863 10:69842278-69842300 CAACCCTGGCAGAAGGTGAAAGG - Intronic
1070580739 10:77717225-77717247 CCTCCCTGGGGGATGGTGGAGGG + Intergenic
1072837105 10:98726948-98726970 ATGCACTGGCAAAAGGTGGAAGG + Intronic
1074021383 10:109587979-109588001 CCTTCCTGGAATGAGGTGGATGG + Intergenic
1074586642 10:114774338-114774360 ACTCCCAGGCTACAGGTGGAGGG + Intergenic
1074813867 10:117130529-117130551 CCTGCCTGGGGAAAGGTGGAAGG - Intronic
1074858001 10:117487551-117487573 CCTCCCAGCAAAAAGGAGGAAGG - Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1079062284 11:17259833-17259855 CCTACCTGGCAACAGCTGGCTGG - Intronic
1079399123 11:20091561-20091583 ACTCCATGGCAGAAGGTGGGAGG - Intronic
1079688394 11:23391655-23391677 TCTCCCTGCCAGAAGGAGGAGGG + Intergenic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1081579921 11:44345201-44345223 CCTCCATGGAAAAACTTGGATGG - Intergenic
1083523855 11:63342433-63342455 CATCCCTGGAAGAAGGTGGAAGG + Intronic
1084472290 11:69370066-69370088 CCTCCCTGGCCAAAGCTGACTGG + Intergenic
1085751205 11:79162743-79162765 CCTCCCTGGCACCAGGTGGCAGG + Intronic
1086115844 11:83249130-83249152 AGTCCCTGCCACAAGGTGGAGGG - Intronic
1087061209 11:93979611-93979633 CATTCCTTGAAAAAGGTGGAAGG + Intergenic
1087369466 11:97264093-97264115 CTCACATGGCAAAAGGTGGAAGG + Intergenic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1089107901 11:116029947-116029969 ATTCCATGGCAGAAGGTGGAAGG - Intergenic
1089469010 11:118706090-118706112 TCACCCTGGCAAAAGGGCGAAGG - Intergenic
1089706856 11:120284352-120284374 CCTTCCTGGGAAAAGGGGGCAGG - Intronic
1090753112 11:129764428-129764450 CATCCCTAGGAAAAGGCGGAGGG + Intergenic
1090805642 11:130200393-130200415 CATCCATGGCAGAAGGTGAAGGG + Intronic
1091451423 12:574602-574624 CTTCCCTGGTAGAAGGTGGCAGG - Intronic
1092633819 12:10417473-10417495 CCAACCTGGCAATAGGAGGAGGG + Intronic
1092634865 12:10432912-10432934 CCAACCTGGCAATAGGAGGAGGG + Intronic
1094738701 12:33264102-33264124 CCTCTATGGCATAAGGTGGAAGG - Intergenic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1099588172 12:84547766-84547788 CCTCCCTGGCCAAAGGAAAAAGG - Intergenic
1101408708 12:104452144-104452166 CCTCCCAGGCAAAAGGGGGCAGG + Intergenic
1102004819 12:109582465-109582487 CCTGTCTTTCAAAAGGTGGAGGG + Intronic
1104096492 12:125562810-125562832 CCACCGTGGCATAAGGTGAAAGG - Intronic
1104513579 12:129403633-129403655 CTTCCCTGGCACAAAGTAGAGGG - Intronic
1105212893 13:18267629-18267651 CCTACCTGCCCAAAGGAGGATGG + Intergenic
1105771774 13:23618924-23618946 CTTACGTGGCAGAAGGTGGAAGG - Intronic
1106295875 13:28413151-28413173 GCTCCCTGGACAATGGTGGAGGG + Intronic
1108112416 13:47089885-47089907 ACTCCATGGCTAAAGGTGGAAGG + Intergenic
1108493163 13:51001032-51001054 CTGCCCTGGCAGAAGGTGGTTGG + Intergenic
1109261391 13:60149177-60149199 CCTTCCTGACAGAATGTGGATGG + Intronic
1110804226 13:79736198-79736220 CCTGCCTGGTGAAGGGTGGATGG + Intergenic
1110843213 13:80166253-80166275 GCTTCCTGCCAAAAAGTGGAGGG - Intergenic
1112050015 13:95635893-95635915 CCACCCTGTCAAAGGGAGGAGGG + Intronic
1112144016 13:96678092-96678114 ATTCCCTGGCAGAAAGTGGAAGG + Intronic
1112248351 13:97754821-97754843 CCCACCTGGCAGAAGGTGGAGGG + Intergenic
1113888221 13:113672118-113672140 GCTCCCTGGCTGACGGTGGAGGG - Intronic
1114707157 14:24738639-24738661 CAATCATGGCAAAAGGTGGAAGG + Intergenic
1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG + Intergenic
1119147507 14:72330511-72330533 CCTCCCTGGCACAAGGAAGGTGG - Intronic
1120502768 14:85317563-85317585 ATTCCATGGCTAAAGGTGGAAGG + Intergenic
1121027260 14:90625661-90625683 CCCCTCTGGCAACAGCTGGAAGG + Intronic
1121148541 14:91607860-91607882 CCTGCCTCTCTAAAGGTGGAGGG - Intronic
1121314942 14:92955493-92955515 CTACCCTGGCACAGGGTGGAGGG + Intronic
1121420984 14:93814069-93814091 ATTCCATGGCAGAAGGTGGAAGG + Intergenic
1123584166 15:21742304-21742326 CCTCCCTGCCAGGAGGCGGAGGG - Intergenic
1123620816 15:22184907-22184929 CCTCCCTGCCAGGAGGCGGAGGG - Intergenic
1124827088 15:33108103-33108125 CTTCCCTGGCACAGGATGGATGG + Intronic
1124934499 15:34157418-34157440 CATCCTTGTCAAAAGTTGGAGGG - Intronic
1126804519 15:52333008-52333030 CTTACATGGCAGAAGGTGGAAGG - Intronic
1127170122 15:56292508-56292530 CCTCACTGCCAAAAGGTCTAAGG - Intronic
1127333886 15:57964991-57965013 TCTGCCTGGCAACAAGTGGAGGG + Intronic
1127492084 15:59474407-59474429 CTTACATGGCAGAAGGTGGAAGG + Intronic
1128517361 15:68351032-68351054 CCTCCCTGGCAATGGATGGGGGG + Intronic
1129080352 15:73033842-73033864 ACTTCCTAGCATAAGGTGGAAGG + Intergenic
1129708815 15:77809771-77809793 CTTCCCTGGCAAAACGAGGCAGG - Intronic
1129892655 15:79081760-79081782 CCTCCCTGGCACTGGGAGGATGG - Intronic
1132791601 16:1692573-1692595 CCTCCCTGGGCTATGGTGGAGGG + Intronic
1132838593 16:1967178-1967200 CCTCCCTGCCAAAAGCTTGCTGG + Intronic
1133292141 16:4729275-4729297 CCTCCATGGCAGAAGCTAGAGGG + Intronic
1133631813 16:7629162-7629184 TCTCCCTGGGAAAAAGTGGATGG + Intronic
1134155417 16:11839023-11839045 CATCCCTGGCACATGGTGTAGGG + Intronic
1135058290 16:19249362-19249384 CCTCCCTGGCTCAAGTTGGCTGG - Intronic
1137478557 16:48831728-48831750 ACTCCCTAGCAAAAGGAGAATGG + Intergenic
1137822386 16:51458491-51458513 CCACCCTGGCAAGAGGAGGTTGG - Intergenic
1138562630 16:57810973-57810995 CCTCCCTGGGTAAAGGAGGAGGG + Intronic
1139156586 16:64450554-64450576 ACACCCTGGCAAAATGTGAAGGG + Intergenic
1140317751 16:73915375-73915397 CCTCCCTTCCTAAAGGAGGAGGG - Intergenic
1141034148 16:80613277-80613299 CATCTCTGGCCAAAGGTGAATGG + Intronic
1142479271 17:208198-208220 CTTTCCTGGTAGAAGGTGGAAGG - Intergenic
1143450898 17:7036202-7036224 CCGCCTTGGGAAAAGGTGCAGGG + Exonic
1143750691 17:9024721-9024743 CCTCCCTTGCAACAGGAGGCGGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146942682 17:36854856-36854878 CCTCCCTAGCAATGGGAGGAGGG + Intergenic
1147457534 17:40547591-40547613 CCACCATGGCAGCAGGTGGAGGG - Intergenic
1147925990 17:43946263-43946285 GCCCTCTGGCACAAGGTGGATGG + Intergenic
1148486881 17:47996362-47996384 CATCCATGGCCAAAGATGGATGG + Intergenic
1148853902 17:50568169-50568191 CCGCCCTGGCACTAGGTGTAAGG - Intronic
1148992992 17:51682526-51682548 GCTCCCTGGATAAAGGTGAAAGG + Intronic
1151509398 17:74549067-74549089 CCTCCCTGTGAAAACGTTGAAGG + Intergenic
1151820308 17:76493435-76493457 CTGCCCTGGCAAGAGGTAGAAGG + Intronic
1152272497 17:79333152-79333174 CCTCCCTGGTAAAGGCTGGCAGG - Intronic
1152312946 17:79561876-79561898 CATCCCTGGCATCAGGGGGAGGG + Intergenic
1153207735 18:2720983-2721005 CATCCCCAGCAAAAGATGGAAGG - Intronic
1155181848 18:23354906-23354928 CCTCCCTAGCAAGGGGTAGATGG - Intronic
1155519740 18:26656596-26656618 CGGCCCGGGCAAAAGGGGGAAGG + Intronic
1160338290 18:78062666-78062688 CCACCCTGGGGAAAGGAGGAAGG + Intergenic
1162750455 19:12826218-12826240 CCTCCAGGGTAAAATGTGGATGG + Intronic
1163090083 19:15013295-15013317 TCTCCCTGGCTACAGGTGGAGGG - Intronic
1164699621 19:30275355-30275377 ACTCCCCAGCAAAAGGTGGGTGG - Intronic
1166312155 19:41969121-41969143 CCTCCCTGGCCCCTGGTGGATGG - Intronic
925702291 2:6650810-6650832 CCTCCCTGGCCAACGGTAGTGGG + Intergenic
926887716 2:17613159-17613181 CCTTCCTGGCTATTGGTGGATGG - Intronic
927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG + Intergenic
927520368 2:23694746-23694768 TCTGCCAGGCACAAGGTGGATGG - Intronic
927599740 2:24430474-24430496 ATCCCATGGCAAAAGGTGGAAGG - Intergenic
928638316 2:33270621-33270643 CCTGCCTGGCAAAGGATGGAAGG + Intronic
930517995 2:52432202-52432224 CCTCCTTGGTGAAAGGTGGAGGG - Intergenic
931200236 2:60090629-60090651 CTTTCATGCCAAAAGGTGGAAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931517860 2:63060009-63060031 CCTGCCTGTCAACAGGTGGCCGG - Intergenic
931974280 2:67625978-67626000 CCTCCCTGAGAAAAGGTTGATGG - Intergenic
932449984 2:71803336-71803358 CCTGCATGGGAAGAGGTGGATGG + Intergenic
933137519 2:78756941-78756963 CCTCCCAGACAAAAGGTAAAAGG + Intergenic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
935155275 2:100478982-100479004 CATCCAAGGGAAAAGGTGGAGGG - Intronic
935261540 2:101359828-101359850 ACTCCCTGGGAAAAGATGAAAGG + Intronic
935281545 2:101522188-101522210 CCTCCCTGGCTCTAGGTGGAAGG - Intergenic
936707717 2:115095340-115095362 CATCCCTGGTAACAGGAGGAAGG + Intronic
936922811 2:117706695-117706717 CCTACCTGGAATAAGGTAGATGG - Intergenic
937990331 2:127658688-127658710 CCTTCCTAGCAAAAGGTGTGGGG - Intronic
939385210 2:141487117-141487139 TTTCCCAGGCAAAAGGTGGAGGG - Intronic
941747253 2:169099896-169099918 CCTCCTTTGCAATAGGTGGTGGG - Intergenic
945038095 2:205721493-205721515 CTGCCCTGGCAAATGGTGGCTGG + Intronic
945175472 2:207039210-207039232 CCTCCCTTGACAATGGTGGAAGG - Intergenic
946686733 2:222278521-222278543 GCTCCCTGGCAAAAAGCAGAAGG - Intronic
948497648 2:238362823-238362845 CCTCCCTGGCTAGAGGCCGAGGG + Intronic
1169622895 20:7527733-7527755 CCTTCCTGGGAAGAGGTGGGAGG - Intergenic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1170255193 20:14334642-14334664 CCTCTGGGGCAAAAGGTGGGGGG + Intronic
1176080225 20:63268846-63268868 GCTCCCTGGAGAAAGGTGGGTGG + Intronic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1179097961 21:38332493-38332515 CCCCCATGGCAGAAGGTGGAAGG + Intergenic
1180612584 22:17107629-17107651 CATCCCTGACAAAGGGTGAAGGG - Intronic
1183101877 22:35589125-35589147 CCACTCTGGCACAAAGTGGATGG + Intergenic
1183799221 22:40147565-40147587 CCCACGTGGCAAAAGGTGGAAGG + Intronic
949332440 3:2937282-2937304 TCTTCCTGGCAAAAGTTGGGAGG - Intronic
949929759 3:9069453-9069475 CTTCCCTGGCATCAAGTGGATGG - Intronic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
950271857 3:11623015-11623037 CCTTTCTTGCCAAAGGTGGATGG + Intronic
950455026 3:13087817-13087839 CTCCCGTGGCAGAAGGTGGAAGG + Intergenic
954429397 3:50461939-50461961 CTTCCCTGGAGCAAGGTGGAAGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954807007 3:53226487-53226509 CCTCGCTGCTAAATGGTGGATGG - Intronic
955420101 3:58727264-58727286 CCTGCCTGGGGAAAGGGGGAGGG + Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956612988 3:71143348-71143370 CCTCCCTGGGAAAAAGTGAAAGG + Intronic
956718628 3:72099385-72099407 CCTCCCTAGTAAAAGCAGGAAGG - Intergenic
957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG + Intergenic
959499866 3:107093639-107093661 GCTGCCTGGCTAAAAGTGGATGG - Intergenic
961488897 3:127237430-127237452 CCTTCCTGGCCAAAGGCAGAGGG - Intergenic
962515522 3:136146813-136146835 CTTCCCTGGTAAAGGCTGGATGG - Exonic
962732112 3:138293039-138293061 CATCCCTGGCAAAGCCTGGAGGG - Intronic
964392686 3:156213919-156213941 CCTCCCTGGTAGACAGTGGATGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
971963258 4:33516996-33517018 GCTCCGTGCCAAAGGGTGGAAGG - Intergenic
974456052 4:62130604-62130626 CCTCCATGGCAAAACCTGCAGGG - Intergenic
978169176 4:105648701-105648723 GTTCCCTGGGAAAAGGTGGGTGG - Intronic
978367324 4:107995995-107996017 GCTCTCTGGAAAAAGCTGGAGGG - Intronic
979420869 4:120503466-120503488 CAATCATGGCAAAAGGTGGAAGG + Intergenic
981943879 4:150318025-150318047 CCTCACTGGCAAAACATGGCTGG - Intronic
981944076 4:150320249-150320271 CCTCACTGGCAAAACATGGCTGG + Intronic
985571915 5:651570-651592 ACTCCCTGGCTATAGGGGGATGG + Intronic
985983362 5:3490082-3490104 CCTCCCTGGCCAGAGGTGTATGG - Intergenic
991442516 5:66665775-66665797 CCTCACTGGTAAAATGTGGTGGG + Intronic
991617270 5:68509817-68509839 CCTGCCTGGCCAAAGTTGAATGG - Intergenic
992986738 5:82238162-82238184 ACTCCCTGCTATAAGGTGGAGGG - Intronic
994079713 5:95694820-95694842 CCTCCCTGGTAGAAAGGGGAGGG - Intronic
997211272 5:132078427-132078449 ACTCACTGACACAAGGTGGAGGG + Intergenic
999776827 5:154818644-154818666 CCTGCCTGCCAAAAGGAAGAGGG + Exonic
1000302668 5:159970463-159970485 CCTCCCTGGGAAAAGTAGAATGG - Intronic
1000930485 5:167245266-167245288 CCTCCCAGACAAAGGGTGCACGG + Intergenic
1001927166 5:175646336-175646358 ACCCCATGGCAAAAGGTAGAAGG + Intergenic
1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG + Intergenic
1004507266 6:16257097-16257119 CCTCTCTGGAAAATGGAGGATGG - Intronic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1006780864 6:36631519-36631541 CCTCCCTGGAGCCAGGTGGACGG + Intergenic
1007351058 6:41273816-41273838 CCTCCCTGGCAGGTGGTGGCAGG - Intronic
1007462106 6:42026411-42026433 CCCCTCTGGTCAAAGGTGGAGGG - Intronic
1008683913 6:53903345-53903367 ACCCCCTGGCAAAGGGTGGGTGG + Intronic
1009868992 6:69432696-69432718 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1009869047 6:69432882-69432904 CCTCCCAGACAAAGGGTGGCCGG + Intergenic
1010188911 6:73174739-73174761 CCTCACTGGCAAACTGGGGATGG + Intronic
1012818880 6:104059573-104059595 CCTTCATGCCAACAGGTGGATGG + Intergenic
1013594292 6:111646896-111646918 CCTCCCTGGGATAAGGGGCAAGG + Intergenic
1014149884 6:118042577-118042599 ACTCCTTGGCAAGATGTGGAAGG - Intronic
1019867603 7:3727469-3727491 TCTCCCTGGCAAAAAGAGGATGG - Intronic
1020372277 7:7445053-7445075 CAATCCTGGCAAAAGGTGAAGGG - Intronic
1022795455 7:33728001-33728023 CCTCCCTGGGGCAAGGTGCATGG - Exonic
1023027181 7:36061491-36061513 GCTCCCTGGAAAAAGGTGCAGGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1027687699 7:81297620-81297642 CCTTCCTTGCAAATGGTTGAAGG + Intergenic
1028621727 7:92834663-92834685 CCTCCCTTTCAAAGGGTGGGGGG + Intronic
1029507007 7:100968705-100968727 CCATCCTTGCAAAAGGTGGCTGG - Intergenic
1031138945 7:117919683-117919705 CATCCCTAGGAAAAGGGGGAGGG + Intergenic
1032279010 7:130486288-130486310 CCTCCCTGGGAACAGGGTGAAGG + Intronic
1034982896 7:155489933-155489955 CTTCTCTGGCAGCAGGTGGAAGG + Intronic
1035616941 8:1009032-1009054 TTTCCCTGGCAAAAGCTGGGTGG + Intergenic
1035625849 8:1069903-1069925 TCAGCCTGGCAAAAGGAGGACGG - Intergenic
1036383839 8:8260698-8260720 CCTCCCTGGCAAAAAAGGAAGGG + Intergenic
1036737828 8:11334052-11334074 ATCCCATGGCAAAAGGTGGAAGG - Intergenic
1037400092 8:18486778-18486800 CAACCATGGCAAAAGGTGAAAGG - Intergenic
1038090987 8:24252762-24252784 TCCCCATGGCAGAAGGTGGAAGG + Intergenic
1038397480 8:27257770-27257792 CCTACCTGGCCAGAGGTGGCTGG - Intronic
1040531483 8:48269926-48269948 CCTCCCTTGCACAAGCTTGATGG + Intergenic
1041815171 8:61962299-61962321 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1044947010 8:97398723-97398745 ATACCATGGCAAAAGGTGGAAGG + Intergenic
1045546444 8:103133212-103133234 CCTCGCTGGCCAGAGGTGGAAGG + Exonic
1046700204 8:117392100-117392122 TCAGCCTGGAAAAAGGTGGACGG + Intergenic
1048325012 8:133432319-133432341 GATCCTTGGCTAAAGGTGGAAGG + Intergenic
1049587979 8:143440710-143440732 CATCCCTGGCCAATGGAGGAAGG - Intronic
1051375731 9:16400539-16400561 CCCCCATGGCTGAAGGTGGAAGG + Intergenic
1051493777 9:17696527-17696549 CAGGCCTGGCAAAAGGTGAAGGG + Intronic
1055168034 9:73220212-73220234 CCATCCTGGCAGAAGGTGAAAGG - Intergenic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1058465930 9:105227404-105227426 CCTTCCTGGAAAAAGATGAATGG - Intergenic
1059627420 9:116081973-116081995 CCTTCCTGCCAAAATGTGGCAGG - Intergenic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1060557965 9:124519143-124519165 CCTCCCTGAAAAAGGGTGGCAGG + Exonic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062595533 9:137297416-137297438 CCTCCCTGGCCACAAGGGGAGGG - Intergenic
1186341057 X:8646591-8646613 CTTCCCTGCCAAAAGGGGGAAGG + Intronic
1190690730 X:52910994-52911016 CTCACGTGGCAAAAGGTGGAAGG + Intergenic
1190695253 X:52944798-52944820 CTCACGTGGCAAAAGGTGGAAGG - Intronic
1190757297 X:53412246-53412268 CCCCTCTGGCAAAAGGGAGAAGG - Exonic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1193117186 X:77786361-77786383 ACCCCCTGCGAAAAGGTGGAGGG - Intergenic
1195265920 X:103179643-103179665 CTTACATGGCAGAAGGTGGAAGG + Intergenic
1196245163 X:113391605-113391627 CCTGCCTGGTGAAAAGTGGAGGG + Intergenic
1197367159 X:125578406-125578428 CTTCCATGGCAGAAGGTGGGAGG + Intergenic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1198742747 X:139858089-139858111 GCCCCATGGCAGAAGGTGGAAGG - Intronic
1201856696 Y:18552475-18552497 CCTTCCTGGCTAGAAGTGGAAGG - Intronic
1201876625 Y:18767905-18767927 CCTTCCTGGCTAGAAGTGGAAGG + Intronic