ID: 927218317

View in Genome Browser
Species Human (GRCh38)
Location 2:20682823-20682845
Sequence TAACTGTGAGGTCCTTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927218313_927218317 -4 Left 927218313 2:20682804-20682826 CCCCAGCTCTGTCATCTATTAAC 0: 1
1: 0
2: 3
3: 30
4: 423
Right 927218317 2:20682823-20682845 TAACTGTGAGGTCCTTAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 135
927218315_927218317 -6 Left 927218315 2:20682806-20682828 CCAGCTCTGTCATCTATTAACTG 0: 1
1: 1
2: 12
3: 95
4: 602
Right 927218317 2:20682823-20682845 TAACTGTGAGGTCCTTAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 135
927218314_927218317 -5 Left 927218314 2:20682805-20682827 CCCAGCTCTGTCATCTATTAACT 0: 1
1: 2
2: 13
3: 120
4: 733
Right 927218317 2:20682823-20682845 TAACTGTGAGGTCCTTAGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927218317 Original CRISPR TAACTGTGAGGTCCTTAGCA AGG Intergenic
901007143 1:6177662-6177684 TGACTGGAAGGCCCTTAGCAAGG + Intronic
902332147 1:15735968-15735990 TGACTGGGAGGTCCCTGGCATGG - Intergenic
902738406 1:18416644-18416666 AAACTGGGAGGACCTTAGCAGGG - Intergenic
903563195 1:24244718-24244740 TAACTGTGCAATCCTTAGTAAGG + Intergenic
903962661 1:27066495-27066517 TATATGTAAAGTCCTTAGCATGG + Intergenic
904267807 1:29327628-29327650 GAATTGTGAGGTCATTAGAATGG - Intergenic
905470362 1:38187246-38187268 TGCCTGTGAGGTGCTTGGCAGGG + Intergenic
908825849 1:68132074-68132096 TAACTGAGATGTCCCTATCATGG + Intronic
909043170 1:70677944-70677966 GAACTGAGAGGTCCTTAGCATGG - Intergenic
910382101 1:86638313-86638335 TAATTGTCAAGTCCTTGGCAGGG - Intergenic
910435501 1:87201681-87201703 TATGTGTGAAGTGCTTAGCATGG + Intergenic
910766133 1:90784187-90784209 TACATGTGAAGTGCTTAGCATGG - Intergenic
911839749 1:102665283-102665305 TAACTGTGAGGCCATTAGACTGG - Intergenic
912221650 1:107684529-107684551 TGACTTTGAGGCCCTTAGGAAGG - Intronic
917439398 1:175053739-175053761 CAACTGTGAGATCCTGAGCAGGG + Intergenic
918917685 1:190666063-190666085 AACCTGTGAGGTGGTTAGCAAGG + Intergenic
920906851 1:210178621-210178643 TAAATGTGAGATTCTTTGCAAGG - Intergenic
921804400 1:219437431-219437453 AGACAGTGAGGTCCTTAGCTGGG - Intergenic
922957299 1:229614080-229614102 TAACTGAGAAGTCCTGAGGAAGG + Intronic
923456247 1:234168093-234168115 GAACTGTGAGGTCCAGGGCAGGG - Intronic
923914836 1:238490928-238490950 TAACTTTGAGGCCTTTAGAAAGG + Intergenic
1067740268 10:48890245-48890267 TAACTGTGGGATGCTTTGCATGG + Intronic
1068636570 10:59354752-59354774 TAATTCTGAACTCCTTAGCAAGG + Intronic
1070548995 10:77475865-77475887 TCACTGTGAGACCCTGAGCAAGG - Intronic
1073344342 10:102771059-102771081 TGGCTGTGAGATACTTAGCATGG + Intronic
1075397739 10:122140128-122140150 TGTTTGTGAGGACCTTAGCAAGG + Intronic
1079917294 11:26385282-26385304 TAACTGTGAGATCCTTTGGTAGG + Intronic
1083115904 11:60459485-60459507 TAACTGTGAGGTCTTTACTAAGG + Intronic
1091256937 11:134196735-134196757 TAAGTGTCTGGTCCTTAGGAAGG - Intronic
1094301646 12:28970773-28970795 AAACTGGGAGGAACTTAGCATGG - Intergenic
1094441696 12:30485307-30485329 TTCCTGTGAAGTGCTTAGCAAGG + Intergenic
1094750915 12:33407070-33407092 TTCCTGTGAAGTCTTTAGCAGGG + Exonic
1096933796 12:55246140-55246162 TAAACGTGAGGACCTAAGCATGG + Intergenic
1100751496 12:97703102-97703124 TAAATGCGAGGTCCTCACCATGG - Intergenic
1101035141 12:100698313-100698335 TAAATGGAAGGTTCTTAGCAGGG - Intergenic
1101734285 12:107451575-107451597 AAAGTCTGAGCTCCTTAGCATGG + Intronic
1107626803 13:42295210-42295232 CAACTGTGAAGTCCTTAGGCAGG + Intronic
1108267313 13:48725113-48725135 TTACAGTGTGTTCCTTAGCATGG - Intergenic
1111972125 13:94927454-94927476 TAGTTGTGAGGTCTTTGGCAAGG - Intergenic
1111976225 13:94968836-94968858 TAACCGTGAGCGCCTAAGCAAGG + Intergenic
1113863765 13:113508181-113508203 TATCTCTGAGGTCATTACCAGGG - Intronic
1114219051 14:20681026-20681048 TAAATGTGTGGACCTTGGCATGG + Intergenic
1119231681 14:72984906-72984928 TACCTGTTAGGTCCTTTGCTAGG - Intronic
1119973129 14:78994827-78994849 CAACTGTTAAGTCCTTATCATGG + Intronic
1125157002 15:36598919-36598941 TAATTGTGAGATCCTTTGGATGG + Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1133844671 16:9442864-9442886 TAACTGGGAAGTGTTTAGCACGG + Intergenic
1133900919 16:9973608-9973630 TGACTGTGATGTGCCTAGCATGG - Intronic
1133987427 16:10679129-10679151 TAAATGTGAAGTCCTTGTCATGG + Intronic
1137490456 16:48928092-48928114 TTACTATGAGGTCATTAGGATGG + Intergenic
1144221471 17:13103724-13103746 AAACTGGGAGGAACTTAGCAAGG + Intergenic
1159109480 18:64040654-64040676 AAAGTGTAAGCTCCTTAGCAAGG - Intergenic
1165332199 19:35146600-35146622 TATCTGTCAGATGCTTAGCAGGG + Intronic
1166650087 19:44566765-44566787 TAACTCAGAGGTCCCTAGCCAGG - Intergenic
926559098 2:14395501-14395523 TAACAGTGAGGTCTGTAGCCCGG - Intergenic
927218317 2:20682823-20682845 TAACTGTGAGGTCCTTAGCAAGG + Intergenic
929562696 2:42965635-42965657 TACAGGTGAGATCCTTAGCAAGG - Intergenic
930863700 2:56102439-56102461 TAACTTTCAGGTCCTTGCCATGG - Intergenic
931370853 2:61661213-61661235 TGACTGATAGCTCCTTAGCAAGG - Intergenic
932697559 2:73969425-73969447 TGACTGTAAGATCCTTAGAACGG + Intergenic
932757117 2:74416642-74416664 TCACTGTGTGCTCCTAAGCAAGG - Intronic
937101668 2:119275939-119275961 GAACTGTGAGGTCCTAACAAGGG + Intergenic
938068709 2:128295345-128295367 TAGCTGTGTGGCCCTGAGCAAGG - Intronic
938099319 2:128487420-128487442 TAGCTGGGAGGTGCTTAGCAAGG + Intergenic
938928206 2:136063532-136063554 AAACTCTGAAGTCCTTACCATGG + Intergenic
939593953 2:144101975-144101997 TAAGTGTGAGGTACTAATCAAGG - Intronic
940013817 2:149082669-149082691 TAAATGTGAGGCACTTAGAATGG + Intronic
943684651 2:190805614-190805636 AAGATGTGAGTTCCTTAGCATGG - Intergenic
946766711 2:223047291-223047313 TATCTGACAGGTCCTTAGTAAGG - Intergenic
947699572 2:232221355-232221377 TAAATGTGAGGTGCTTCCCATGG + Intronic
947832193 2:233149441-233149463 GAACTGGGAGGACCTTGGCAGGG + Intronic
1172460967 20:35118401-35118423 TAGCTGTGAGATCTTTAGCAAGG + Intronic
1173070645 20:39761511-39761533 TTCCTGTGAGGGCCTTAGGAAGG + Intergenic
1174166303 20:48585988-48586010 TAACTGTGTGGTTCAAAGCATGG - Intergenic
1175728689 20:61337016-61337038 TCACTGTGAGGTTCACAGCAAGG + Intronic
1183844145 22:40526602-40526624 TAACTGGCAGGTTCTGAGCAAGG + Intronic
949808325 3:7978815-7978837 GAAGGGTGAGGTCCTTGGCAAGG - Intergenic
952533962 3:34290835-34290857 TACTTTTGAGTTCCTTAGCAGGG - Intergenic
953761816 3:45694313-45694335 TAACTGTGAGGTCATCAGTCAGG + Intronic
953929344 3:46998228-46998250 TAGGTGTGAGGACCTGAGCAAGG + Intronic
959884291 3:111480750-111480772 AAACTGTGAGCTCCTTATTAAGG - Intronic
960697089 3:120406701-120406723 TGCCTGTGAGGTCCTAATCATGG + Intronic
961727901 3:128944927-128944949 TCATTGTGAGGTACTTACCAGGG - Intronic
962229078 3:133644737-133644759 TAACTGTCAAGTCCTTAACATGG + Intronic
964580773 3:158234840-158234862 TAACTGTAAGTTCCTATGCATGG + Intronic
966023042 3:175239882-175239904 TAACTGTCAGGTGCTTTACATGG - Intronic
967357759 3:188591878-188591900 TAACTGTGAGGTACTTGGCATGG + Intronic
969150185 4:5162752-5162774 TAAGTTTGGGGTCCTTGGCAGGG - Intronic
969240752 4:5895590-5895612 TATCTGTTAGGTGCTTACCATGG - Intergenic
969989597 4:11248502-11248524 TGACTGGGAGTTACTTAGCATGG - Intergenic
969999464 4:11349983-11350005 TTACAGTGGGGTCCTTAGGATGG - Intergenic
970501004 4:16677125-16677147 TATCTGTGAAGTTCTTAACATGG + Intronic
971162895 4:24151844-24151866 TAAGTATGAGGTACTTAGCTGGG - Intergenic
973227860 4:47806595-47806617 CAACTGTGAGCTCCTAAGAAAGG + Intronic
973696263 4:53493936-53493958 AAAGTCTGAGGTCCTTAGCATGG + Intronic
974540245 4:63224841-63224863 TAACTGAGATCTCCTTAGCCTGG - Intergenic
974552737 4:63399865-63399887 TAACTGTAAGGCACTTAGCTTGG + Intergenic
975379601 4:73683704-73683726 TAACTGTGGGGTTTTTTGCAAGG - Intergenic
976353419 4:84086124-84086146 CAACTGTGAGATCCTGACCATGG + Intergenic
978029030 4:103915512-103915534 TAACTGTGAGTTCCTCATCTGGG + Intergenic
978090070 4:104704490-104704512 TAAGTCTGATTTCCTTAGCATGG - Intergenic
985127450 4:186708895-186708917 GAACAGTGAGGTCCTTTCCAGGG - Exonic
985225689 4:187759468-187759490 AAAATATGAGTTCCTTAGCATGG + Intergenic
986216191 5:5721385-5721407 TGAGTGCAAGGTCCTTAGCAGGG + Intergenic
986235113 5:5902405-5902427 TAACTGTAAGATCTTTAGCCAGG + Intergenic
986702351 5:10423083-10423105 CAACCCTGAAGTCCTTAGCAAGG - Intronic
990109220 5:52303505-52303527 TAAGTGTTAGGTCTTCAGCAAGG + Intergenic
991711908 5:69416342-69416364 TAACTGTGATGGCCCCAGCAGGG - Intronic
993715340 5:91270502-91270524 TAAGTGTGGAGTCCTTATCATGG + Intergenic
996189241 5:120518372-120518394 TAACTGTGGGGTCCTTGAGAGGG + Intronic
996896791 5:128493875-128493897 TTACTGTGAGGTTTTTAGCTTGG + Intronic
997594169 5:135095203-135095225 TAACTGTGTGCTGCTTAGCTGGG + Intronic
998619854 5:143781902-143781924 TAGCTGTGAGATCTTGAGCAAGG - Intergenic
1000981254 5:167819482-167819504 TAACTGTGAGGTCCTGCCAAAGG + Intronic
1001406633 5:171481637-171481659 GACCTGTGAGGTGCTTAGCAGGG + Intergenic
1001713649 5:173797453-173797475 TAACAGTGAGGTCTTTATCAGGG - Intergenic
1001717296 5:173826710-173826732 TAACCTTGAGGTCATGAGCAAGG + Intergenic
1003929562 6:10910803-10910825 TAATTGTGAGGTATTTTGCAGGG + Exonic
1007294476 6:40811485-40811507 TAACTGTGTGATCCTGAGCAAGG - Intergenic
1008614670 6:53214872-53214894 TAACTGGGAGGAACTTAGCAAGG - Intergenic
1011253834 6:85401479-85401501 CAACTGTGAGGACCTTTGAAAGG + Intergenic
1012372465 6:98524263-98524285 TGTCTGTGAAGTCCTTAGCAGGG - Intergenic
1014458483 6:121666347-121666369 TTACTGTGACCTCCCTAGCAAGG + Intergenic
1018604156 6:165579176-165579198 AAATTCTGAAGTCCTTAGCATGG - Intronic
1020339142 7:7090415-7090437 TATCTGTGAAGTCCATAGAATGG + Intergenic
1021809003 7:24384764-24384786 TGAAAGTGAGGTCCTTAGTAGGG + Intergenic
1022458101 7:30577188-30577210 TAACTGTGAGGTTCTTATTTAGG - Intergenic
1023056822 7:36297364-36297386 GCACTGTGTGGTCCTTAGCGCGG - Intronic
1024560919 7:50644628-50644650 TAACTGTGATTTCCTGAGTAGGG + Intronic
1027560608 7:79724339-79724361 AAACTGGGAGGAACTTAGCAAGG + Intergenic
1030834044 7:114261685-114261707 TATATGTGAGGTGATTAGCATGG + Intronic
1032053724 7:128667735-128667757 TAACAGTGATGGCCTTAGGACGG - Intergenic
1034409738 7:150933980-150934002 TAACGATGAGGTCCTTAGAGAGG - Intergenic
1036610072 8:10342012-10342034 TAACTGTGAGGTCCTCATCTAGG + Intronic
1038713758 8:29973358-29973380 TATCTGTAAAATCCTTAGCATGG - Intergenic
1044301845 8:90593491-90593513 ATAATGTGAGGTGCTTAGCACGG + Intergenic
1044717875 8:95117293-95117315 AAACTGTGAGGTCCCTGGAAAGG + Intergenic
1045396129 8:101762347-101762369 TAACTGTAAGTTCCTTATAAAGG + Intronic
1050494092 9:6221375-6221397 TACCTGTCAGGTCCTAGGCACGG - Intronic
1052938135 9:34110570-34110592 TAAATCTGAGATACTTAGCATGG + Intronic
1054867320 9:70015739-70015761 AAACTGGGAGGATCTTAGCAAGG - Intergenic
1056086406 9:83153901-83153923 CAACTGTCAGGTACTCAGCATGG - Intergenic
1060446702 9:123695573-123695595 TGACTGTGAGGTCCTTTGCTGGG + Intronic
1062531003 9:137000174-137000196 TCACTTTGTGGTCCTTTGCATGG + Intergenic
1186126217 X:6417183-6417205 TAACTGTGAGGTCCTGCGTTGGG + Intergenic
1186860877 X:13671238-13671260 CAGCGGGGAGGTCCTTAGCATGG - Intronic
1188019582 X:25142812-25142834 TAAATGTGCAGTCCATAGCATGG + Intergenic
1188974130 X:36653225-36653247 AAACTGGGAGGGGCTTAGCAAGG + Intergenic
1194666466 X:96682514-96682536 TAAGTGTGAGGTACTGTGCAAGG - Intergenic
1199868547 X:151876059-151876081 AGACAGTGAGGTCCATAGCATGG - Intergenic
1200749978 Y:6935998-6936020 CAACTGGGAGCTCCTTAGAAAGG - Intronic
1201244859 Y:11993733-11993755 TAACTGGGAGGTACCCAGCAGGG - Intergenic