ID: 927219349

View in Genome Browser
Species Human (GRCh38)
Location 2:20692849-20692871
Sequence GGTGTCATGCTGAGAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927219344_927219349 8 Left 927219344 2:20692818-20692840 CCTGAGCAGGGTGGTAAACGGCA 0: 1
1: 0
2: 0
3: 7
4: 67
Right 927219349 2:20692849-20692871 GGTGTCATGCTGAGAGTGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927219349 Original CRISPR GGTGTCATGCTGAGAGTGAA AGG Intronic
900690362 1:3977143-3977165 GAGGTCATGCTCAGAGTGAGTGG + Intergenic
901101771 1:6724667-6724689 GGTGACATGTTCAGAATGAACGG - Intergenic
901416883 1:9122444-9122466 AGTGTCTTGCTGAGAGACAACGG - Intronic
904248964 1:29208896-29208918 GGTGACAGGCTAAGAGTGAAAGG + Intronic
905007322 1:34720369-34720391 GATTTTATGCTGAAAGTGAAAGG + Intronic
906062346 1:42957408-42957430 GGTGTCCCGCTGAGACTGAGCGG - Intronic
906294614 1:44641815-44641837 GGGGTCAGGGTCAGAGTGAATGG + Intronic
906566365 1:46803976-46803998 GGTGTCATGCAGAGAGTTCCGGG + Intronic
907143903 1:52214780-52214802 GGTGTCATTCTGAGACTAGAGGG + Intronic
907748342 1:57237477-57237499 AGTGACATTCTGAGAGAGAAAGG - Intronic
909277048 1:73699961-73699983 GATGTCATGGTGAGAGGGTAGGG + Intergenic
909408676 1:75322680-75322702 GGAAGCAAGCTGAGAGTGAAAGG - Intronic
910391918 1:86754687-86754709 GGGCTCATGCTGGGAGTCAAAGG - Intergenic
910592905 1:88947188-88947210 GGTGTCAGGCTGTGACTGAGAGG - Intronic
911391180 1:97245878-97245900 AATGTGTTGCTGAGAGTGAAAGG - Intronic
911667848 1:100574370-100574392 GGGGTCTACCTGAGAGTGAAGGG + Intergenic
915171636 1:153982196-153982218 GGTGTCATGGTGTGAATGGATGG + Intronic
917650981 1:177077217-177077239 GGAGTCACGCTGAGATTGAGGGG - Intronic
920652818 1:207851452-207851474 GGTGGCATGCAGAGTGAGAAGGG + Intergenic
922330609 1:224571942-224571964 GGGGTCATGCTGTGACTGAGAGG + Intronic
923337200 1:232980704-232980726 AGTGTCATGCTGAGATTTAAAGG + Exonic
924188490 1:241521948-241521970 GGTGTCCTGCTGAGGGACAAGGG + Intergenic
924189688 1:241537683-241537705 GGTCTCATGATGATGGTGAAAGG + Intronic
924548554 1:245052859-245052881 GGTCCTCTGCTGAGAGTGAATGG - Intronic
1063407112 10:5806904-5806926 TGGGTCATGCTTAGTGTGAAAGG - Intronic
1064490822 10:15854609-15854631 GGTGTTATATTGAGAGTGAGAGG + Intronic
1065617938 10:27547825-27547847 GATGTTATGCTGAGTGTGATGGG + Intergenic
1066960163 10:42215267-42215289 GATTTCAGGCTGAGAGAGAATGG - Intergenic
1068046548 10:51893438-51893460 GGTGGCATACAGAGAGTGAATGG + Intronic
1070262227 10:74868870-74868892 GGTATCATGCAGATAGTTAATGG + Intronic
1071833463 10:89395226-89395248 GGGGTCATGCTGTGACTGAGAGG - Intronic
1073517612 10:104091299-104091321 AGTGTCATTCTGAGGGTGAGGGG + Intergenic
1074290029 10:112131477-112131499 GGTGTCAGGGTGAGTGAGAAAGG - Intergenic
1075212936 10:120507013-120507035 GGTTTCCTGCTGAGTGTGAGAGG + Intronic
1075274961 10:121085035-121085057 GGTGTCGTGCTGAGGGTCACTGG - Intergenic
1077293313 11:1810883-1810905 TGCGTCATGCTGAGTGAGAAAGG + Intergenic
1078914931 11:15770282-15770304 GGTGACATGCTTGAAGTGAATGG - Intergenic
1079668704 11:23138826-23138848 GTTTTCAAGCTGAGAGTGACAGG - Intergenic
1081342166 11:41942054-41942076 GGGGTCCATCTGAGAGTGAAGGG + Intergenic
1083714915 11:64569638-64569660 GCTGTCATCCTGTGGGTGAAGGG - Exonic
1085193481 11:74649977-74649999 GGAGTCACGCTGATAGTAAAAGG - Intronic
1085541871 11:77278298-77278320 GCTGTCTTGCTGAGAGGGAACGG - Intronic
1086595816 11:88569395-88569417 GGTCTATTGCTGAGAATGAAGGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087305052 11:96479293-96479315 GATGTCATGGAGAGAGAGAATGG + Intronic
1087691899 11:101330094-101330116 GGAATCATGCTGTGACTGAAAGG + Intergenic
1089301242 11:117500025-117500047 GGTGTCTGGCAGAGAGTGACAGG - Intronic
1090236684 11:125153428-125153450 GGGTTAATGCTGAGAGGGAAGGG - Intergenic
1090605533 11:128419642-128419664 GGCAGCATGCTGAGAGTGAGGGG + Intergenic
1091777721 12:3195522-3195544 GGTGGCAAGCTGAGAATGATCGG + Intronic
1093904217 12:24670926-24670948 AGAGTCATGCAGAGATTGAATGG - Intergenic
1095180178 12:39138109-39138131 GGTGTCATGCCCAGGGGGAAAGG + Intergenic
1096993087 12:55820891-55820913 AGTGTTAAGCTTAGAGTGAAGGG - Exonic
1097776692 12:63655524-63655546 GGTCATTTGCTGAGAGTGAAAGG + Intronic
1098932493 12:76436038-76436060 GTTTTCATGCTTAGAGAGAATGG - Intronic
1104176649 12:126339517-126339539 TATGTCATTCTGAGATTGAATGG - Intergenic
1106076872 13:26468020-26468042 GTTTTCATGCAGAGAGTGATTGG + Intergenic
1106410299 13:29506638-29506660 GGGGTCATTATGAAAGTGAAGGG - Intergenic
1106508465 13:30392342-30392364 GGTGGCATGCCCAGAGTGAAGGG + Intergenic
1108281401 13:48865778-48865800 GGTGTTTTGCTGAGAATGGAAGG + Intergenic
1108466387 13:50720233-50720255 TGTGGCAAGCTGAGAGTCAAGGG + Intronic
1108625254 13:52222402-52222424 GGAGTCATGCTGTGACTGAGAGG - Intergenic
1108660804 13:52584014-52584036 GGAGTCATGCTGTGACTGAGAGG + Intergenic
1108855958 13:54792569-54792591 AGTCTCATCCTGAGAGTGGATGG - Intergenic
1109933673 13:69250371-69250393 GATGGCATGCTGAGAATAAATGG + Intergenic
1110681262 13:78315039-78315061 TGTGTCATTTTGAGGGTGAAAGG - Intergenic
1111077016 13:83249672-83249694 GCTGTGATGCTGAGAGTTGAAGG + Intergenic
1112372310 13:98804561-98804583 GGTCTCAGGCTGTGAGTAAATGG - Intronic
1112468098 13:99662736-99662758 GGTGTAATGCTCAGTGAGAATGG - Intronic
1113135245 13:107081755-107081777 GGTGTCATGCTAATAGTTAAAGG + Intergenic
1116368586 14:44101925-44101947 CATGTCCTCCTGAGAGTGAATGG - Intergenic
1117156791 14:52950459-52950481 GATGTCACCCTGAGAGTGACCGG - Exonic
1118763732 14:68896247-68896269 GGAGTCAGGCTGCGAGAGAAAGG - Intronic
1120713831 14:87819321-87819343 TGTTTCCTGCTGAGAGTGAGGGG + Intergenic
1122164946 14:99815860-99815882 TGTGTCATGCTCAGAGGTAAAGG + Intronic
1122293156 14:100690298-100690320 GGTGGGAGGCTGAGAGTGAAAGG + Intergenic
1202895381 14_GL000194v1_random:3505-3527 GGGGTCCCGCTGAGAGTGAAAGG - Intergenic
1123784197 15:23652588-23652610 GGTGTAATGGTAAGAGTGATGGG - Intergenic
1124670370 15:31633679-31633701 GAGGCCATGCTGTGAGTGAAGGG - Intronic
1125174729 15:36807748-36807770 GTTGTAATGCAGAGAGTAAAGGG + Intronic
1126860756 15:52880357-52880379 GGCTGCATGCAGAGAGTGAAAGG + Intergenic
1127597661 15:60502809-60502831 GGTGTTGTTCTGAGAGTCAAAGG + Exonic
1127628678 15:60805165-60805187 GGCGTCATGGTGAGAGGGGATGG - Intronic
1128536791 15:68497674-68497696 GGTGTGATCCTGAAAGTGCAAGG - Intergenic
1131914693 15:97251974-97251996 GCTGTTATCCTGATAGTGAACGG + Intergenic
1132053044 15:98626343-98626365 GGAGGCAAGCTGGGAGTGAATGG - Intergenic
1133466015 16:6027809-6027831 GGTGACAAATTGAGAGTGAAGGG + Intronic
1136145467 16:28313826-28313848 TGGGTCGTGCCGAGAGTGAAGGG + Intronic
1140857350 16:78989744-78989766 GGTGAGATGCTGAGAGTAATGGG + Intronic
1141284162 16:82655556-82655578 CGTGTGATGCTGAGAGTGATGGG + Intronic
1141306353 16:82867481-82867503 GGTGGAAAGCTGAGAGTTAAGGG - Intronic
1142314290 16:89333721-89333743 GATGTCCTGCAGAGGGTGAATGG - Intronic
1145289834 17:21534390-21534412 TGTGTCATGCAGAAAGGGAAAGG - Exonic
1146139869 17:30356380-30356402 AGGGTCATTGTGAGAGTGAAAGG + Intergenic
1150839986 17:68599127-68599149 TTTGTAATGCTGAGATTGAAGGG - Intronic
1153967151 18:10192290-10192312 GGTGTCCTTCTGAGAGAAAAGGG + Intergenic
1155667641 18:28330598-28330620 GATGTCCTTCAGAGAGTGAATGG - Intergenic
1156352586 18:36313663-36313685 GGTGTCTTTCAGTGAGTGAATGG - Intronic
1158374719 18:56849965-56849987 TGTGTCATGGTGAATGTGAAGGG - Intronic
1158634918 18:59148065-59148087 GGTGTGTTGCTGAGAGTGAGTGG + Intronic
1159077396 18:63696839-63696861 AGTGTCATGCTGAGTGAGAGAGG - Intronic
1159382307 18:67676059-67676081 GGGGTCCTGCTGAGGGTGAGAGG + Intergenic
1160284403 18:77527607-77527629 CCTTTCATGCTCAGAGTGAAGGG - Intergenic
1161373207 19:3925175-3925197 GGTGTCATTATGAGCGAGAAGGG - Exonic
1162492014 19:10998305-10998327 GGTGTCATATCGAGAGTGCATGG + Intronic
1163861506 19:19745491-19745513 GGGGTCATGCTGAGATGGAGAGG + Intergenic
1166756747 19:45197067-45197089 GGTGGGATGCTGGGAGTGGAGGG + Intronic
925856492 2:8134415-8134437 TGTGCCATCCTGAGAGTGGATGG + Intergenic
927159782 2:20246129-20246151 GGTGACCTGCTGAGATTGTAAGG - Intergenic
927219349 2:20692849-20692871 GGTGTCATGCTGAGAGTGAAAGG + Intronic
928511595 2:32009508-32009530 GCTGTCTTGCAGGGAGTGAAGGG - Intronic
929438197 2:41944860-41944882 GGTGGCAGGCTCAGAGTGAATGG - Intronic
931576989 2:63728425-63728447 TGTATGATCCTGAGAGTGAAGGG + Intronic
932067432 2:68580655-68580677 GATGTAAAGCTGAGAGTAAATGG + Intronic
932769327 2:74491813-74491835 GGGGTCATGGTGACAGTGATGGG - Intronic
936526966 2:113247907-113247929 GGTGACATGCAGAGAGTTATGGG + Intronic
938240876 2:129741557-129741579 AGTGTCTTGCTGACACTGAAGGG - Intergenic
939368710 2:141268971-141268993 AGTGTCATGCTGAGTATGAGTGG - Intronic
939798834 2:146681598-146681620 GGTGGCATGATAAAAGTGAATGG + Intergenic
939834967 2:147118650-147118672 GATGTAAAGCTGAGAATGAAGGG - Intergenic
940715093 2:157213335-157213357 GCTGTCATGATGAGAGAGGAAGG - Intergenic
941924971 2:170885570-170885592 GGAGTCAGGATGAGAGGGAAGGG - Intergenic
941932421 2:170955372-170955394 GGGGTCATGAGGGGAGTGAAGGG + Intronic
942926947 2:181445304-181445326 GGGAACATGCTGAGAGGGAAGGG + Intergenic
945192113 2:207199435-207199457 GATGAGATGCTGAAAGTGAAAGG - Intergenic
945760061 2:213903386-213903408 GGTGTTGAGCTGTGAGTGAAGGG - Intronic
947692627 2:232153818-232153840 GGTGTCACTCTGAAAGTGATGGG - Intronic
947695286 2:232181429-232181451 GGTGTCACTCTGAAAGTGATGGG - Intronic
947718986 2:232356627-232356649 GGTGTCACTCTGAAAGTGACAGG + Intergenic
948180982 2:235980093-235980115 GATTTCATGAGGAGAGTGAAAGG + Intronic
1169209173 20:3756091-3756113 GGTGTCATCCTATGAGCGAATGG - Intronic
1171311978 20:24151941-24151963 TGTGTAATGGTGAGAGTGAGGGG - Intergenic
1173598207 20:44273732-44273754 GGAGTCATCTAGAGAGTGAAGGG - Intronic
1174372174 20:50098395-50098417 TGTGTGAGGATGAGAGTGAAGGG + Intronic
1174885269 20:54327396-54327418 GGTCTCATCCTGAGAGAGCATGG + Intergenic
1175612464 20:60363188-60363210 GGTGTCATGCAGAGAAAGGAAGG - Intergenic
1176615078 21:9019492-9019514 GGGGTCCCGCTGAGAGTGAAAGG - Intergenic
1177820389 21:26024591-26024613 GTAGTTTTGCTGAGAGTGAAAGG + Intronic
1181619337 22:24077808-24077830 GGAGTGGTGCTAAGAGTGAAGGG + Intronic
1182004233 22:26945798-26945820 GGGGTAATGCTGAGAGTGATTGG + Intergenic
1182170415 22:28223087-28223109 AGTGTCATGCTGAGAGCGTCTGG - Intronic
1182190942 22:28459917-28459939 GCTGTCCTGCGGAGAGAGAATGG + Intronic
1182219701 22:28748390-28748412 GTTGTCCAGGTGAGAGTGAATGG - Intronic
1184039011 22:41932602-41932624 GGGGCCATGCTGAGAGTGGCTGG - Intergenic
1185378973 22:50498046-50498068 GTTGCCATGCTGGGAGTGCAGGG + Intergenic
949197786 3:1334160-1334182 GGTTTCCTGCTGGGAATGAATGG + Intronic
950230483 3:11271620-11271642 GGTGGCTTGCTGAAAGTTAAAGG - Intergenic
953191328 3:40690804-40690826 GGTGAAATGGTGAGAGAGAAGGG + Intergenic
955194796 3:56795234-56795256 GGTGTTAAGCAGAGATTGAATGG + Intronic
956938730 3:74132969-74132991 GCTGTTCTCCTGAGAGTGAATGG - Intergenic
958739742 3:98055118-98055140 GGTGTAATGATGAGAGAGAAAGG - Intergenic
959500024 3:107096296-107096318 GATGTCCTGCTGCCAGTGAATGG + Intergenic
959825682 3:110793186-110793208 AGTGTCTTCCTAAGAGTGAAGGG - Intergenic
960140479 3:114147515-114147537 CGTGCCATGCTGGTAGTGAACGG + Exonic
960175732 3:114515606-114515628 GGTTACTAGCTGAGAGTGAAGGG - Intronic
961101915 3:124206980-124207002 AATGTCTGGCTGAGAGTGAAGGG + Intronic
964293222 3:155204688-155204710 GGTCATATGCTGAGAGTAAAAGG - Intergenic
966068640 3:175847375-175847397 GGTGTAATTCTGAAAGGGAAGGG - Intergenic
967943330 3:194783158-194783180 GGAGTGGTGCTGAGAGTGAGTGG + Intergenic
970855750 4:20648195-20648217 GGTGTCCTGCTGAGGGGAAACGG + Intergenic
975914266 4:79304898-79304920 GGTGTCATACTGAGAGGCCAGGG + Intronic
976959128 4:90944881-90944903 TATATCATGCTCAGAGTGAATGG - Intronic
977584471 4:98759890-98759912 AGTGACCTGCTGAGAGTGAGTGG - Intergenic
984305599 4:177985320-177985342 GGTGTCATGCTGACAGGGCCTGG + Intronic
985547666 5:518225-518247 GGAGAGATGCTGAGTGTGAAGGG + Intronic
986163111 5:5249422-5249444 GGTCTCATGCAGGGAGTCAAGGG - Intronic
986580135 5:9257332-9257354 TGTGTCCTGCTGACAGTAAAAGG - Intronic
987584005 5:19831024-19831046 GGAGTCTTTGTGAGAGTGAAGGG + Intronic
989116480 5:37958800-37958822 GGTGTCCTTATGAGAGAGAAGGG + Intergenic
989997646 5:50854801-50854823 GGGGGCCTCCTGAGAGTGAATGG - Intergenic
990018434 5:51095640-51095662 GGGGTCATGAAGAGAGTCAAAGG - Intergenic
995907337 5:117141417-117141439 GGATGCATGTTGAGAGTGAAGGG + Intergenic
998106315 5:139471421-139471443 AGGGCCATGCTGAGAGTGCAGGG + Intergenic
998323465 5:141255780-141255802 GGAGTCATGCAGAGTGGGAATGG + Intergenic
999374241 5:151075866-151075888 GGAGTCATGCTGAGAGGCCAGGG - Intronic
999474474 5:151885765-151885787 GGTTTAATGCTGAGGGTGATGGG + Intronic
1000448761 5:161358338-161358360 GGTGTCATGGTGGAAGGGAAAGG + Intronic
1003481928 6:6542579-6542601 GATGTCCTGCAGGGAGTGAATGG - Intergenic
1004913108 6:20306112-20306134 TGTGTGATGCTGAGAGTGAGGGG - Intergenic
1006660303 6:35636344-35636366 GGTGTTTTTCTGAGAATGAATGG - Intronic
1008910274 6:56724633-56724655 GGTGAGATGCTGTGAGTGCATGG - Intronic
1010993407 6:82505281-82505303 GGTATAATGCTGACATTGAAAGG - Intergenic
1019578816 7:1750148-1750170 GGTGTCATGGTGGGGGTGACAGG + Intergenic
1019720735 7:2569045-2569067 GGTGTCCTGGAGAGAATGAAGGG + Intronic
1019804988 7:3117199-3117221 TGTGTCATGCTGACAGTTCACGG + Intergenic
1020564297 7:9776871-9776893 GGTGTGTTGCTGACAGGGAATGG + Intergenic
1021934796 7:25619375-25619397 GGAGTCATGGTGGGAGTGGAAGG - Intergenic
1022935608 7:35173182-35173204 GGTCATTTGCTGAGAGTGAAAGG + Intergenic
1025632971 7:63293357-63293379 GGTGTCATGCTATGAGAGGAAGG + Intergenic
1025649726 7:63454826-63454848 GGTGTCATGCTATGAGAGGAAGG - Intergenic
1026416222 7:70183557-70183579 GGAGCCATGCTGAGAGGGACAGG + Intronic
1026549912 7:71359324-71359346 GATCTCATGGTGAGAGTGGAAGG + Intronic
1027714460 7:81652879-81652901 GATGTCATACAGAGTGTGAAGGG + Intergenic
1029831568 7:103265909-103265931 GGTCATTTGCTGAGAGTGAAAGG + Intergenic
1030244706 7:107370235-107370257 TGTGTGTTTCTGAGAGTGAATGG - Intronic
1032962277 7:137050092-137050114 CGTCTCATTCTGTGAGTGAAGGG + Intergenic
1034292096 7:149940958-149940980 GGTGTCATCCTTAGACTTAAGGG - Intergenic
1034321191 7:150184258-150184280 GGTGATGTGCTGAGAGTTAAGGG - Intergenic
1034771557 7:153783006-153783028 GGTGATGTGCTGAGAGTTAAGGG + Intergenic
1036591522 8:10172922-10172944 GGTGTTATGCTGAGAATGACTGG - Intronic
1038621628 8:29148981-29149003 TGTGACAAGCTCAGAGTGAAAGG + Intronic
1042082549 8:65071190-65071212 GGTGTGATGCTGAGACTGGTTGG - Intergenic
1044549286 8:93494544-93494566 TGTATGAGGCTGAGAGTGAAAGG - Intergenic
1047940958 8:129826993-129827015 GGGGTCAGCCTGAGAGTGGAGGG - Intergenic
1048087793 8:131202807-131202829 TGAGTCATGGTGACAGTGAATGG - Intergenic
1048187108 8:132251378-132251400 GGGGTCATCCTCACAGTGAATGG - Intronic
1050202463 9:3160300-3160322 GATGTCAAGCTGGGAGTGTAAGG - Intergenic
1050288000 9:4123949-4123971 GGGGGCATGCTGGGAGTGGATGG - Intronic
1051326906 9:15981792-15981814 GAAGTCATGCTGAGAGTATATGG - Intronic
1053152378 9:35751223-35751245 GAGGTAATGCTGAGAGGGAACGG - Intronic
1056900194 9:90592057-90592079 TGTGTCAAGCTGAGACTGATGGG - Intergenic
1057425902 9:94949423-94949445 TCTGTCCTCCTGAGAGTGAAAGG - Intronic
1059428461 9:114235955-114235977 GGTGTCATTCTGAGAGCAATAGG - Intronic
1061884169 9:133583290-133583312 GCTGTCAGGCTGAGACTGCAGGG + Intronic
1186519090 X:10189560-10189582 GGGGTGATGCTGAAAATGAAGGG + Intronic
1189088479 X:38052057-38052079 GGTTTCTTCATGAGAGTGAATGG + Intronic
1189818268 X:44845663-44845685 GGTTTCATGCTTGGAGTAAAAGG + Intergenic
1190525283 X:51323420-51323442 GGTGTCATTCTCAGTGTGAAGGG + Intergenic
1190544241 X:51508513-51508535 GGTGTCATTCTCAGTGTGAAGGG - Intergenic
1193903250 X:87209675-87209697 GGAGTCATACTGTGACTGAAAGG + Intergenic
1194378586 X:93166097-93166119 GGTACCATGTTGAGAGTCAAAGG + Intergenic
1197055924 X:122118629-122118651 AGAGTCATGCAGATAGTGAATGG - Intergenic
1199868647 X:151876895-151876917 GCTGTCCTCCTGATAGTGAATGG - Intergenic
1200094690 X:153651806-153651828 GGTGGCATCCTGAGAGTGACAGG + Intergenic