ID: 927219557

View in Genome Browser
Species Human (GRCh38)
Location 2:20694673-20694695
Sequence CTGTGCCTGCAGAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 1, 2: 3, 3: 71, 4: 514}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927219557_927219564 -4 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219564 2:20694692-20694714 ACAGAGGGGAGCGGTGGGAATGG 0: 1
1: 0
2: 4
3: 61
4: 735
927219557_927219563 -9 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219563 2:20694687-20694709 CAGGCACAGAGGGGAGCGGTGGG 0: 1
1: 0
2: 1
3: 37
4: 368
927219557_927219565 -3 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219565 2:20694693-20694715 CAGAGGGGAGCGGTGGGAATGGG 0: 1
1: 0
2: 0
3: 30
4: 479
927219557_927219571 26 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219571 2:20694722-20694744 AAAGGAGGAGTAGGTCCTATGGG 0: 1
1: 0
2: 3
3: 7
4: 113
927219557_927219562 -10 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219562 2:20694686-20694708 GCAGGCACAGAGGGGAGCGGTGG 0: 1
1: 0
2: 6
3: 54
4: 613
927219557_927219566 8 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219566 2:20694704-20694726 GGTGGGAATGGGAGCGCCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 136
927219557_927219570 25 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219570 2:20694721-20694743 CAAAGGAGGAGTAGGTCCTATGG 0: 1
1: 0
2: 0
3: 8
4: 118
927219557_927219572 27 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219572 2:20694723-20694745 AAGGAGGAGTAGGTCCTATGGGG 0: 1
1: 0
2: 0
3: 9
4: 122
927219557_927219568 17 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219568 2:20694713-20694735 GGGAGCGCCAAAGGAGGAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 222
927219557_927219567 11 Left 927219557 2:20694673-20694695 CCTGCTTCTCTCTGCAGGCACAG 0: 1
1: 1
2: 3
3: 71
4: 514
Right 927219567 2:20694707-20694729 GGGAATGGGAGCGCCAAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927219557 Original CRISPR CTGTGCCTGCAGAGAGAAGC AGG (reversed) Intronic
900351017 1:2234598-2234620 CAGGGCCTCCAGAGAGAAGGCGG + Intronic
900392007 1:2437650-2437672 CTGTCCCTAGAGAGAGAGGCAGG - Intronic
900393270 1:2443095-2443117 CTGTGCCCCCAGGGAGAACCAGG - Intronic
901324104 1:8356732-8356754 TTGTGCCAGCAGAGAGGAGAGGG - Intronic
902399599 1:16150738-16150760 CTGAGCCTGGTGTGAGAAGCTGG + Intronic
903063257 1:20684663-20684685 CTGCGCCTGGAGAGAGGATCAGG + Intronic
903213144 1:21829692-21829714 CTGGGCCTGGAGAGTGAGGCAGG - Intronic
903250322 1:22048624-22048646 CTCTGCTTGCAGTGGGAAGCTGG + Intergenic
904043966 1:27599438-27599460 CGGAGCCTGGGGAGAGAAGCAGG - Intronic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
904830908 1:33306381-33306403 CTGAGCCTGCAGAATGCAGCTGG - Intergenic
905105172 1:35559575-35559597 CTGGGCCTGGAGAGAGTAGCAGG + Intronic
905340694 1:37275383-37275405 CTGTGGCTGCAGGGAGAGGATGG - Intergenic
906044900 1:42821063-42821085 AGGTGCCTGCAGAGGGAGGCAGG - Intronic
906149449 1:43579045-43579067 CTGCTGCTGCAGAAAGAAGCAGG - Intronic
906508267 1:46395767-46395789 GTGTGGCTGCAGAGTGCAGCGGG - Intronic
906789923 1:48650179-48650201 GTGGGACTGCAGAGAGGAGCAGG + Intronic
906937277 1:50225482-50225504 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
907647930 1:56262877-56262899 GGGAGCCTGCAGAGTGAAGCAGG + Intergenic
908775042 1:67631700-67631722 CTGGGCGTGTAGAGGGAAGCTGG + Intergenic
908784417 1:67721095-67721117 CTGAGCCTGCAGAGAGGAAGTGG + Intronic
909257956 1:73448357-73448379 CTGAGGCTGCACAGAGGAGCAGG + Intergenic
910038774 1:82822000-82822022 ATGAGCCTGGAGAGAGAGGCAGG + Intergenic
910263474 1:85313944-85313966 CTGTGCCTGCCAAGATGAGCAGG + Intergenic
910388976 1:86717534-86717556 CTCTGCCTGCTGAGAGTAGCTGG + Intronic
910460635 1:87444774-87444796 CTGAGGCTGCACAGAGTAGCAGG + Intergenic
910465441 1:87494171-87494193 CAGTGTCTGCAGAGAGGTGCAGG + Intergenic
912246119 1:107964017-107964039 CTGTCGCTGCTGAGAGAGGCTGG + Intronic
912503986 1:110143150-110143172 CACTGCCTGCAGACAGGAGCAGG + Intergenic
913039928 1:115012282-115012304 CTGAGGCTGCAGAGAGCAGCAGG - Intergenic
913402195 1:118448752-118448774 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
914319409 1:146544832-146544854 CTGTGGCTGCAGGGGGAACCAGG + Intergenic
914804292 1:150981490-150981512 CTGTCTCTGCACAGAGCAGCAGG - Intergenic
914999385 1:152574182-152574204 GTGTCCCTGCAGAGAGAAGGGGG + Intronic
916102875 1:161407730-161407752 CTTAGCCTTCAGTGAGAAGCTGG + Intergenic
916146846 1:161747727-161747749 CTGCACCTGCACAGATAAGCAGG + Intergenic
916589416 1:166176034-166176056 CTGAGCCTGCAGGGAGGAGCTGG - Intergenic
916829218 1:168474270-168474292 CTGAGGCTGCACAGAGCAGCCGG - Intergenic
917406822 1:174715889-174715911 CTGTGCCTGAAAAGTGCAGCTGG - Intronic
917842668 1:178994739-178994761 CTCAGCCTCCAGAGAGCAGCTGG + Intergenic
918321144 1:183365881-183365903 CTGTGCCTGCAGAGTGATGCTGG - Intronic
918396745 1:184121203-184121225 CTGGTCCTCCAGAGAGAAGTAGG + Intergenic
919371950 1:196739115-196739137 CTGAGGCTGCATAGAGCAGCAGG + Intronic
919430057 1:197481359-197481381 CAGTGAGTGCAAAGAGAAGCAGG + Intergenic
919536771 1:198797158-198797180 CTAGGGCTGCACAGAGAAGCAGG + Intergenic
919841180 1:201610587-201610609 CTGTGCCTGCGGACAGAGGCAGG - Intergenic
922045856 1:221945821-221945843 CTCTGCCTTCGGAAAGAAGCAGG - Intergenic
923048862 1:230376146-230376168 CTGTGCCTGCATAGAAAGGAAGG - Intronic
923172678 1:231431339-231431361 CCGAGGCTGCACAGAGAAGCAGG + Intergenic
923701234 1:236302132-236302154 CTGGGCCTGGAGTGAGAAGTGGG + Intergenic
924276470 1:242392530-242392552 CTCTGTCTGCAGTGAGAATCCGG + Intronic
1062956865 10:1546288-1546310 CTTTCCGTGCAGAGAGCAGCAGG + Intronic
1064655185 10:17549514-17549536 CTGTGCCTGCTGGGAGCAACTGG - Intergenic
1065783159 10:29189539-29189561 CTATGCCTCCAGGGAGAACCTGG + Intergenic
1066083463 10:31955032-31955054 CTGAGACTGCACAGAGAAGCAGG - Intergenic
1067030289 10:42875184-42875206 GCCTGCCTGCGGAGAGAAGCGGG - Intergenic
1067557532 10:47283231-47283253 TTGTACCTGCAGCAAGAAGCCGG + Intergenic
1067768619 10:49108105-49108127 CTCTGCCTGGCCAGAGAAGCAGG + Intronic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1068374766 10:56164622-56164644 CTGAGGCTGCAGAGAGCAGCAGG - Intergenic
1068439226 10:57030645-57030667 CTATGCCTGCCGATATAAGCAGG + Intergenic
1069329964 10:67280147-67280169 CTGTGCTTGGAGTGAGAAACAGG - Intronic
1069838801 10:71326552-71326574 CTGTGCCGGCCGAGACAGGCAGG - Intronic
1070413861 10:76171097-76171119 CTGTGCCTAGAGAAAGAAGCTGG + Intronic
1070593456 10:77816696-77816718 CTGAACCTGCAGAGAGGAGCGGG + Exonic
1070756419 10:78996237-78996259 CTGTGTCTGCAAAGAGGGGCTGG - Intergenic
1071572113 10:86703035-86703057 CTCTGGCTGCGGAGAGCAGCAGG + Intronic
1071858051 10:89645318-89645340 CTGGGCTTGCAGAGAGGAGATGG + Exonic
1073082564 10:100869163-100869185 CTCTGCCCACAGAAAGAAGCAGG + Intergenic
1073185691 10:101613897-101613919 CTGGGCCTGCGGGGAGAAGATGG + Intronic
1073423634 10:103443153-103443175 CTCTCCCTCCAGAGAGGAGCAGG + Exonic
1073447584 10:103590627-103590649 CTCAGCATGCAGAGAGGAGCTGG - Exonic
1074699175 10:116078426-116078448 CTGTCCATGCTGGGAGAAGCAGG + Intronic
1075241322 10:120781450-120781472 TTATGCCTGCAGAGATCAGCAGG + Intergenic
1075295270 10:121269831-121269853 CTTTGGCTGCAGAAGGAAGCAGG - Intergenic
1075402938 10:122173848-122173870 CTGTGCCCCCAGAGAGGGGCTGG - Intronic
1075679254 10:124320827-124320849 CTGTGCCTGCTGAGTGAAGGTGG + Intergenic
1076335567 10:129704325-129704347 CTCTGCCTGCAGAGTGAGCCCGG + Intronic
1076506115 10:130973612-130973634 CTGTGCTTGCAGGGTGAAGAGGG + Intergenic
1076509681 10:131003906-131003928 ACGGGGCTGCAGAGAGAAGCAGG - Intergenic
1077498515 11:2898267-2898289 CTGGGTCTGGAGAGAGAGGCAGG - Intronic
1079106739 11:17576851-17576873 CAGTGGCTGCAGAGAGAGACGGG - Exonic
1079250875 11:18786663-18786685 CTGTGGCTGCAGATGGAATCTGG + Intronic
1079465301 11:20724033-20724055 CTGAGGCTGCACCGAGAAGCTGG + Intronic
1079465307 11:20724074-20724096 CTGAGGCTGCACAGAGCAGCTGG + Intronic
1080811885 11:35712651-35712673 CTGTCAGTGCAGAGAGGAGCTGG - Intronic
1080997225 11:37618934-37618956 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1081164123 11:39786717-39786739 AGGTGCCTGCAGGGAGAAGTGGG - Intergenic
1081208690 11:40305159-40305181 CAGTGCCTGCAAAGAGCAGAGGG - Intronic
1083182798 11:60998666-60998688 ATGAGCCTGCAGAGAGCACCTGG - Intronic
1083327212 11:61878842-61878864 CTGAGCCTGGGGAGAGAGGCAGG + Exonic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1084717338 11:70882350-70882372 CTGTGCCTGTAGCTAGGAGCTGG + Intronic
1085134416 11:74072992-74073014 CTGGGTCTGAAGAGAGGAGCTGG + Intronic
1085616618 11:78004909-78004931 CTGTGGCAGCAGCCAGAAGCTGG - Intergenic
1085717896 11:78889362-78889384 GTGTGGCTGCAGTGAGGAGCAGG - Intronic
1085981411 11:81730809-81730831 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
1086092666 11:83020240-83020262 CTGAGCCTGCACAGGCAAGCGGG - Intronic
1086737627 11:90326627-90326649 CTGCACCTGCACAGATAAGCAGG + Intergenic
1087290533 11:96315783-96315805 CAGTCCCTGCACAGAGGAGCTGG + Intronic
1088704329 11:112448068-112448090 CTGAGCCTGCAGGGACAGGCAGG + Intergenic
1089646875 11:119886306-119886328 CTGCCCCTGCAGAGACCAGCAGG - Intergenic
1090159985 11:124482519-124482541 CTGAGCCTTCAGTGACAAGCCGG + Intergenic
1090238247 11:125165012-125165034 GGGAGCGTGCAGAGAGAAGCTGG + Intronic
1090550904 11:127818918-127818940 CTGAACCTGCCGAGAGAAGTAGG + Intergenic
1092125813 12:6074298-6074320 CTGTCCTTGCAGTGAGGAGCTGG - Intronic
1093182018 12:15977567-15977589 CTCAGCCTCCAGAGAGTAGCTGG + Intronic
1093351034 12:18103401-18103423 CTGAGGCTGCACAGAGCAGCTGG + Intronic
1094553929 12:31479381-31479403 CAGTGACTGCAGAGAGAAATAGG - Intronic
1095226749 12:39686503-39686525 CTGAGGCTGCACAGAGCAGCAGG + Intronic
1095256420 12:40041857-40041879 CTTTGCCTGTAGACAGAAGTTGG + Intronic
1095447870 12:42300505-42300527 CTCAGCCTTCAGAGAGGAGCTGG - Intronic
1095607502 12:44087577-44087599 CTCAGCCTGCCGAGAGCAGCTGG + Intronic
1097839353 12:64306481-64306503 TTGTGCCTCCTGAGAGTAGCTGG + Intronic
1098305090 12:69095076-69095098 CTGTACCTTCATAGAGAGGCTGG + Intergenic
1099222929 12:79935299-79935321 CTGGGCCACCAGAGGGAAGCGGG + Intronic
1100081582 12:90858551-90858573 CTGCACCTGCACAGATAAGCAGG - Intergenic
1101516413 12:105439579-105439601 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1101733303 12:107444152-107444174 AGGGTCCTGCAGAGAGAAGCTGG + Intronic
1102122173 12:110450172-110450194 GTGTGTGTGCCGAGAGAAGCGGG - Intronic
1104237442 12:126952792-126952814 CTGCATCTGCAGAGATAAGCAGG - Intergenic
1104598542 12:130136798-130136820 CTGCGCCTCCAGAGAGAGCCTGG + Intergenic
1104750390 12:131234735-131234757 ATTTGGCTGCAGACAGAAGCTGG - Intergenic
1104782330 12:131429727-131429749 ATTTGGCTGCAGACAGAAGCTGG + Intergenic
1104980108 12:132569909-132569931 CTGGGCCTGCAGAGAGAGGGTGG - Exonic
1105264973 13:18807956-18807978 CTGTGCCTGCATCCAGAAGCTGG + Intergenic
1106819762 13:33451622-33451644 TTGGGTCTGCATAGAGAAGCCGG + Intergenic
1107750409 13:43559156-43559178 CTGTGCCTGTACAAGGAAGCAGG + Intronic
1108214898 13:48174552-48174574 CTGTTCCAGCAGAGGGAAGTGGG - Intergenic
1109297553 13:60552910-60552932 CTGGGGCTGCACAGAGCAGCAGG + Intronic
1110222710 13:73090282-73090304 CTGAGCCTGCCAAGAGTAGCAGG + Intergenic
1111769230 13:92575468-92575490 CAGAGCCTGCAGAGGGAACCTGG + Intronic
1111778612 13:92693952-92693974 CTGAGTCTGCACAGAGTAGCAGG - Intronic
1112029977 13:95447987-95448009 CTGTGCCTGCGGCGAGAGGTGGG + Intronic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112512213 13:100020052-100020074 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1113894615 13:113755600-113755622 CTCGGCCTGCAGAGCCAAGCAGG + Intergenic
1113917435 13:113882953-113882975 CTCTGCCTGCACAGAGGACCCGG + Intergenic
1114472937 14:22976211-22976233 CTGTGCCTGCAGAGTTAGGGAGG + Intronic
1116898852 14:50342786-50342808 CTGGGCCTGCTGAGATAAGCTGG + Intronic
1117428174 14:55622882-55622904 ATGAGGCTGCAGAGAGAGGCAGG - Intronic
1117574875 14:57087846-57087868 CTTTGTCTGCAGGGACAAGCAGG + Intergenic
1118083322 14:62387252-62387274 CTGAGGCTGCAGAGAGCAGCTGG - Intergenic
1118185487 14:63533828-63533850 CTCAGCCTGCGGAGAGTAGCTGG - Intronic
1118258679 14:64227136-64227158 CTGTGCCTGCCAACAGATGCAGG - Intronic
1118767042 14:68916841-68916863 GTGTCCCTGGAGAGAGAAGGAGG - Intronic
1119117511 14:72039276-72039298 CTGTACCCGCAAAGATAAGCTGG + Intronic
1119662110 14:76459541-76459563 CTGAGGCTGCAGAGAGAGGGTGG + Intronic
1121073650 14:91048452-91048474 CTGTGACTGCAGGGAGAATGAGG - Intronic
1121323350 14:93005654-93005676 CTGCTTCTGCAGAGAGAAACCGG + Intronic
1121471140 14:94155421-94155443 CTGAGGCTGCACAGAGAAGCGGG - Intronic
1122071149 14:99206072-99206094 CTGCTCCTGGAGAGAGAATCTGG - Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122410806 14:101525357-101525379 GTCTGACCGCAGAGAGAAGCTGG - Intergenic
1122862847 14:104590218-104590240 CTGGGCCTGGGGAGAGATGCTGG - Intronic
1123132007 14:105994906-105994928 AGGAGCCTGCAGAGAGAACCAGG + Intergenic
1123167163 14:106336842-106336864 AGGCGGCTGCAGAGAGAAGCAGG + Intergenic
1123169779 14:106361553-106361575 AGGAGGCTGCAGAGAGAAGCAGG + Intergenic
1124042231 15:26116191-26116213 CTGTCCCTGCAGACAGAATTTGG + Intergenic
1124444944 15:29722304-29722326 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1124581846 15:30962816-30962838 CTCTCGCTGCAGAGAGAGGCCGG + Intronic
1125102311 15:35928629-35928651 CAGTCTCTGCAGTGAGAAGCAGG + Intergenic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125886023 15:43230171-43230193 CTTTGACTGCAGAGTGAAGTGGG - Intergenic
1126369071 15:47926772-47926794 CTCTTCCTGCTGAGAGAAGCTGG - Intergenic
1127057008 15:55142395-55142417 CTGTCTATGCAGAAAGAAGCAGG + Intergenic
1129119445 15:73387073-73387095 CTGTACCTGCTGAGTGCAGCTGG - Intergenic
1131442766 15:92471398-92471420 CTGTACCTGCTGAGAGCACCAGG - Intergenic
1132543845 16:524127-524149 CTCTGCCTAGAGGGAGAAGCTGG + Intergenic
1132552471 16:559247-559269 CTGAGCCTGCAGAGAGCCCCAGG + Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132591786 16:729276-729298 CCCTCCCTGCAGAGAGGAGCCGG + Exonic
1132869160 16:2108022-2108044 CTCGGCCTGCAGAGGGAGGCTGG - Exonic
1133114291 16:3567411-3567433 TTGTCACTGCATAGAGAAGCAGG + Intronic
1133288048 16:4700041-4700063 CAGGGGCTGCAGGGAGAAGCCGG + Intronic
1133401683 16:5492193-5492215 CTGTATCTGCAGAGAGGAGTAGG - Intergenic
1133895997 16:9929499-9929521 CTGTGGATTCAGAGAGAAGTGGG - Intronic
1134124894 16:11609922-11609944 CTGGGCCTGGAGAGAGAAGGTGG - Intronic
1134201088 16:12199589-12199611 TTGTACCTGCAGAGAGAACGAGG + Exonic
1134550212 16:15135419-15135441 CTCGGCCTGCAGAGGGAGGCTGG - Intronic
1134718257 16:16367576-16367598 CTCGGCCTGCAGAGGGAGGCTGG + Intergenic
1134956495 16:18384583-18384605 CTCGGCCTGCAGAGGGAGGCTGG - Intergenic
1135304027 16:21353751-21353773 CCATGCCTGCTGAGAAAAGCTGG - Intergenic
1135321800 16:21502316-21502338 CCGTGCCTGCGGAGAGAGGCGGG + Intergenic
1136294167 16:29292181-29292203 CTGTCCCTGCAGCGTGAACCCGG - Intergenic
1136300761 16:29332888-29332910 CCATGCCTGCTGAGAAAAGCTGG - Intergenic
1137035026 16:35562708-35562730 CTGTGCCTACAGTAAGAATCAGG + Intergenic
1137408054 16:48205588-48205610 CTGTGCCTGCTGAGCCAGGCAGG - Intronic
1137482461 16:48864118-48864140 CATGGCCTGCACAGAGAAGCTGG - Intergenic
1138582154 16:57948689-57948711 CTGTGCCTGGAGTTAGGAGCAGG - Intronic
1139454308 16:67060090-67060112 CTCAGTCTGCAGAGAGTAGCGGG + Intronic
1139515947 16:67452469-67452491 CTGTCCCTGCAGGGACAAGTGGG + Intronic
1139884437 16:70198455-70198477 CTGTGACTGCAGGGACAGGCAGG - Intergenic
1140014114 16:71165249-71165271 CTGTGGCTGCAGGGGGAACCAGG - Intronic
1140368081 16:74397036-74397058 CTGTGACTGCAGGGACAGGCAGG + Intergenic
1140485525 16:75290213-75290235 CTGTGGCTGCAGAATGGAGCAGG - Intergenic
1140968836 16:79993475-79993497 CTGGGCATGCAAACAGAAGCTGG - Intergenic
1141217980 16:82043001-82043023 TGGTTCCTGCAGAGAGGAGCAGG + Intronic
1141516654 16:84549310-84549332 CAGGGCCTGCTGGGAGAAGCAGG + Intronic
1141949523 16:87331648-87331670 CTGCCCCTGCAGAGACAGGCTGG - Intronic
1142062486 16:88039678-88039700 CCATGCCTGCTGAGAAAAGCTGG - Intronic
1142100071 16:88266227-88266249 CTGTCCCTGCAGCGTGAACCCGG - Intergenic
1142620231 17:1160971-1160993 CGGTGCCTTCTGAGGGAAGCGGG + Intronic
1142686737 17:1581453-1581475 CTGGGCGTGCAGAGCGCAGCGGG - Intronic
1142869078 17:2808973-2808995 GCGTGGCTGCAGGGAGAAGCAGG + Intronic
1143197540 17:5087648-5087670 CTGGGCCTGAAGAGAGAGGAGGG + Intronic
1143680228 17:8470755-8470777 CTGTGCCTTGGGAGAGGAGCAGG + Intronic
1143854185 17:9836354-9836376 ATATGCCTACAGAGAGAAGAAGG - Exonic
1143928857 17:10399542-10399564 GCGCGCCTGCAGACAGAAGCGGG - Exonic
1144163986 17:12589848-12589870 AGGTGCAAGCAGAGAGAAGCTGG + Intergenic
1144827088 17:18111548-18111570 CTGTGCCTGCACAGAGGATGGGG + Intronic
1145001890 17:19311194-19311216 CTGTCCCTGCAGTGGGAAACAGG + Intronic
1145015221 17:19392151-19392173 CTGCACCTGCAGAGAGAATAGGG - Intergenic
1145270852 17:21404214-21404236 TAGTGCCTGGAGAGTGAAGCTGG + Intronic
1145309058 17:21691601-21691623 CAGTGCCTGGAGAGTGAAGCTGG + Intergenic
1145923885 17:28631673-28631695 CTGTGCCTGCTGAGAAAAAGAGG + Exonic
1146296585 17:31655003-31655025 CTGCGACTGCAAAGAGCAGCAGG + Intergenic
1146491132 17:33283163-33283185 GTGTGCCTGGGGAGAGATGCTGG - Intronic
1146708299 17:35018482-35018504 CTTTGCCTGCAGGGAGCAGTGGG - Intronic
1146931347 17:36780333-36780355 CTCTGCCAGCAGTGTGAAGCTGG - Intergenic
1148741702 17:49896987-49897009 CTGCTCCTGGAGGGAGAAGCAGG - Intergenic
1149519755 17:57309890-57309912 CTGGGCCTGCCACGAGAAGCTGG + Intronic
1150136167 17:62696505-62696527 CTGCCCCTTCAGAGAGATGCAGG - Intergenic
1150150707 17:62807280-62807302 CTGTGACTGCAGAGAAAAAGGGG + Intronic
1150541439 17:66104222-66104244 CTCTGCCTGAAGAGAGGAGAGGG + Intronic
1151657207 17:75501685-75501707 CTGTTCCTGCAGAGACAAAAAGG + Exonic
1151963679 17:77420236-77420258 CTGTTCAGGAAGAGAGAAGCGGG + Intronic
1152022182 17:77785862-77785884 CTGGGCCAGGGGAGAGAAGCTGG + Intergenic
1152776538 17:82205508-82205530 CTGGGCCTGCAGGGAGCAGCTGG - Intronic
1152898466 17:82926833-82926855 GTGTGCCTGCAGGGAGGAGAGGG - Intronic
1153686113 18:7547259-7547281 CTGTGCTTTCAGTGAGAAACAGG + Intergenic
1154423421 18:14253588-14253610 CTGTGCCTGCATCCAGAAGCTGG - Intergenic
1154492642 18:14933434-14933456 CTGGGCCTGCAGAGAGCAAGGGG + Intergenic
1155071403 18:22320135-22320157 CTGCACCTGCAGAGTGAGGCAGG + Intergenic
1155298653 18:24408776-24408798 ATGAGACTGGAGAGAGAAGCAGG + Intergenic
1156226644 18:35116324-35116346 ATGAGACTGCAGAGGGAAGCGGG + Intronic
1157520037 18:48339181-48339203 CTGTGCCTGCTCAGAGATGCAGG - Intronic
1157903377 18:51542631-51542653 CTGTGCCTGCAGGGAGGGGATGG - Intergenic
1158943230 18:62425475-62425497 CTCTCCCTGAAGACAGAAGCAGG - Intergenic
1159196424 18:65122282-65122304 CTGAGGCTGCGCAGAGAAGCAGG - Intergenic
1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG + Intergenic
1159803078 18:72924153-72924175 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1160130821 18:76223516-76223538 CTGTACTTGGAGAAAGAAGCAGG - Intergenic
1160286355 18:77547175-77547197 CTGTGCCAGCAAAGAGGAGCTGG + Intergenic
1160322851 18:77912595-77912617 CTGTGCATACAGAGAGACGGGGG - Intergenic
1160430964 18:78812285-78812307 CTGTGCCTGCAGGGAGGAGGTGG - Intergenic
1160765375 19:805292-805314 CTGGCCGTGCAGAGAGCAGCAGG - Intronic
1160903448 19:1440676-1440698 CTGTCCCTGCAGACAGGAGCAGG - Exonic
1161394311 19:4037257-4037279 CTGCTCTTGCAGAGAGAAGTGGG + Intronic
1161412069 19:4122616-4122638 ATGTCCTTGCAGAGAGAAGATGG - Intronic
1161772011 19:6235897-6235919 CTGTGCCTGGGGACAGCAGCAGG - Intronic
1162529485 19:11227679-11227701 CTGTAGCTGCAGGTAGAAGCTGG + Intronic
1162761533 19:12891475-12891497 CTGTGCTTGCAGAGAAAGGCGGG + Exonic
1163354051 19:16798131-16798153 TTGTGCCTTCAGAGTGGAGCAGG + Intronic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165070951 19:33254549-33254571 CTGTGCTGGTAGAGAGAGGCTGG + Intergenic
1165096371 19:33411954-33411976 CTCTGCCTGCAGACTGAGGCTGG - Intronic
1166384438 19:42372475-42372497 CTGGGACTGGAGAGAGAAGGTGG - Intronic
1166435984 19:42766834-42766856 GTGCGCTTGCAGGGAGAAGCGGG - Intronic
1166781321 19:45345087-45345109 CTCTGCCGGCAGAGTGAGGCGGG - Intronic
1167169802 19:47823545-47823567 CAGAGGCTGCAGAGAGAGGCTGG + Intronic
1167702727 19:51060094-51060116 CTGTGGGTGCAGAAAGAAGGTGG + Intronic
1168317693 19:55491186-55491208 CTGGGCATGCAGAGAGCAGGCGG - Intronic
925202414 2:1979288-1979310 CCGTGGCAGCAGAGAGAAGGAGG + Intronic
925440234 2:3879356-3879378 ATGAGTCTGCAGAGGGAAGCCGG + Intergenic
925742335 2:7017181-7017203 CTGAGCCTCCAGATAGAGGCAGG - Intronic
926332078 2:11833910-11833932 CTCTGCCTGGTGAGAGGAGCAGG - Intergenic
927219557 2:20694673-20694695 CTGTGCCTGCAGAGAGAAGCAGG - Intronic
927484041 2:23476906-23476928 ATGTGCCTGCAGAGGCAAGGAGG + Intronic
927665133 2:25026718-25026740 CTCAGCCTCCAGAGAGTAGCTGG + Intergenic
929612796 2:43284325-43284347 CTGAGGCTGCACAGAGCAGCTGG - Intronic
929882168 2:45846627-45846649 CTGTGGCTGCAGAAAGAAACAGG - Intronic
930453689 2:51578401-51578423 ATGTGCCTGCTGAGGAAAGCTGG - Intergenic
930961501 2:57267278-57267300 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
930970252 2:57386212-57386234 CTCTGCCTGCAGAAAGAGGAAGG + Intergenic
931584827 2:63813788-63813810 CTGTGACTGGAGAGAGAATAAGG - Intronic
931845765 2:66202406-66202428 CTGTGCTTTGAGAAAGAAGCAGG + Intergenic
934522897 2:95031024-95031046 CTGTGGCTGCACTGAGAAGGTGG + Intronic
934875592 2:97916505-97916527 CTGTGGCTGAAGAGAGAAGTGGG - Intronic
934949929 2:98569357-98569379 CAGCGCCTGCACAGAGAGGCCGG - Intronic
935737650 2:106119282-106119304 CTGTCCCTGCAGGCTGAAGCAGG - Intronic
935966964 2:108488281-108488303 CTGTGTCTGCAGACAGTAACAGG + Intronic
936157372 2:110057215-110057237 ATGTATCTGCAGAGAGAAGAAGG - Intergenic
936187320 2:110314229-110314251 ATGTATCTGCAGAGAGAAGAAGG + Intergenic
936241706 2:110793458-110793480 CCATGTCTGCAGAGAGAAACTGG + Intronic
936381528 2:111990974-111990996 TTGAGCCTGCAGCCAGAAGCAGG + Intronic
936513846 2:113169271-113169293 CTGAGCTTGGAGAGAGAAGGTGG - Intronic
936850829 2:116895787-116895809 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
937436306 2:121884693-121884715 CTCTGCCTGCAGGCGGAAGCTGG - Intergenic
938213231 2:129486051-129486073 CTGAGCCAGAAGAGAGCAGCAGG + Intergenic
938949526 2:136244013-136244035 CTGTCCCTGCAGAGAGAAAGGGG + Intergenic
940403102 2:153268908-153268930 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
942825455 2:180169794-180169816 CTGAGCCTGCACAGAGCAGTGGG + Intergenic
943210031 2:184951316-184951338 CTGTGACTGCAGAGAGACAGAGG - Intergenic
943423296 2:187697611-187697633 CTGAGGCTGCATAGAGCAGCAGG - Intergenic
944371221 2:198985708-198985730 CTGAGGCTGCAGAGAGAAGCTGG + Intergenic
945493429 2:210481960-210481982 CTGCAGCTGCAGAGAGGAGCTGG + Intronic
948130530 2:235597301-235597323 CTGTGCTTGCAGAGTGGAGGTGG - Intronic
948817657 2:240521050-240521072 CTGTGCCTCCAGAGAAAACTTGG + Intronic
948872793 2:240812116-240812138 CTGTGCCTGCAGTGACTTGCGGG - Intronic
1169800298 20:9506921-9506943 CTGTGCCTGCAGGGAGAGGGTGG - Intergenic
1170525084 20:17228481-17228503 GTGTGGGTGCAGAGAGAAGGTGG + Intronic
1170898525 20:20437689-20437711 CAGTGCCTCCTGAGAAAAGCTGG - Intronic
1171370732 20:24660718-24660740 CTGTGCCAGCAGGCTGAAGCTGG - Intronic
1171885770 20:30651652-30651674 CTGTGCCTGCACCCAGAAGCTGG + Intergenic
1172098699 20:32473237-32473259 CGGTGCCTGCAGAGCCCAGCTGG - Intronic
1172782607 20:37446177-37446199 CTGTGCATGCAGAGGGATGGGGG - Intergenic
1174047091 20:47741262-47741284 CTGTGGCTGCAGAGAGTGGGCGG - Intronic
1174056268 20:47800483-47800505 GTGTTCCAGCAGAGAGAAGGAGG + Intergenic
1174492787 20:50913763-50913785 CTTGGCCTACAGAGGGAAGCTGG + Intronic
1174753439 20:53135280-53135302 GTGTGACTGGAGAGGGAAGCAGG - Intronic
1175068806 20:56314516-56314538 CTGGGGCTGCAGGGAGATGCAGG + Intergenic
1175989826 20:62782889-62782911 CTCGGCCTCCAGGGAGAAGCTGG - Intergenic
1176205217 20:63884551-63884573 CTGTGCTTCCAGAGAAAAACAGG - Intronic
1176249339 20:64112821-64112843 TTGTGCCTCCAGAGAGCACCTGG - Intergenic
1176850048 21:13906422-13906444 CTGTGCCTGCATCCAGAAGCTGG + Intergenic
1177586118 21:23097885-23097907 CTGCACCTGCACAGATAAGCCGG - Intergenic
1178589380 21:33896394-33896416 TTCTGCCTTCAAAGAGAAGCAGG + Exonic
1180710051 22:17833305-17833327 CCTTGCCTGCAGTGAGAGGCCGG + Intronic
1180984505 22:19896599-19896621 CTGGGCCGGGAGGGAGAAGCAGG - Intronic
1182026969 22:27127742-27127764 CTGTCTCTGCCTAGAGAAGCTGG + Intergenic
1182056242 22:27357450-27357472 CTATGCATGCAGAGAGCAGGAGG - Intergenic
1182684850 22:32114110-32114132 CTGTCCCTACAGAGTGAAGTTGG - Intergenic
1182698438 22:32211880-32211902 CTCTCCCTCCAGGGAGAAGCTGG - Intergenic
1183012116 22:34955365-34955387 CTGTGCCTCCACAGAACAGCTGG - Intergenic
1183777161 22:39973791-39973813 CTGTGGCTGGTGAGAGGAGCTGG - Intergenic
1184108588 22:42382651-42382673 GAGAGCCTGCAGAGACAAGCTGG - Exonic
1184119157 22:42439104-42439126 CTGAGGCTGGAGAGAGACGCAGG + Intergenic
1184158853 22:42686303-42686325 CTGTGCCTGCAGGGTGCAGTCGG + Intergenic
1184175330 22:42785742-42785764 AGGTGCATGCAGAGAGAAGGAGG - Intergenic
1184509545 22:44925668-44925690 CTGTGCCAGCCAAGAGCAGCAGG - Intronic
1185169665 22:49285498-49285520 CTGCTCCTGCAGAGAGAAGGAGG - Intergenic
1185236442 22:49716305-49716327 CTGTGAGTGCAGAGAGGACCAGG - Intergenic
949563909 3:5227963-5227985 CTGTGAGTGCTGAGAGACGCTGG - Intergenic
950092237 3:10304255-10304277 CTGTTCCTGCAGAGAGGTGCCGG - Intronic
950479505 3:13235776-13235798 CAGTGCCTGCAGAGAGGGGAGGG + Intergenic
951916784 3:27809407-27809429 CTGTGGCTGCTGGGAAAAGCTGG - Intergenic
952920834 3:38282740-38282762 CGGTCCCTGCAGAGGGAGGCTGG + Intronic
953082071 3:39630118-39630140 ATGTGCTTCCAGAGAGAAGAGGG - Intergenic
953095009 3:39766550-39766572 CTGAGACTGCACAGAGCAGCAGG + Intergenic
953359165 3:42280013-42280035 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
954132518 3:48567753-48567775 TGATGCCTGCAGGGAGAAGCTGG - Exonic
954975728 3:54692429-54692451 CTGTGCCTGCAGAGGGAGCAGGG + Intronic
955520290 3:59769091-59769113 CTGTGCCTGCACACAGAGGTTGG + Intronic
956448826 3:69352838-69352860 CTTTGCCTCCAGAAAGAAGAAGG - Intronic
956911360 3:73821428-73821450 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
957252400 3:77790299-77790321 TTCTGCCTGCTGAGAGAAACTGG + Intergenic
957444062 3:80292020-80292042 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
957783487 3:84849462-84849484 CTGGGGCTGCACAGAGAAGCAGG + Intergenic
957956549 3:87195893-87195915 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
958579615 3:96001111-96001133 CTGCACCTGCACAGATAAGCAGG + Intergenic
958843217 3:99233836-99233858 TTATGCCTGCAGAGAGTACCAGG + Intergenic
959085627 3:101849107-101849129 CTGGGCCTGCAGAGGGAGGCGGG - Intronic
959219614 3:103500124-103500146 CAGTGGCTGCAGAAACAAGCAGG + Intergenic
959515465 3:107261625-107261647 CGGTAGCTACAGAGAGAAGCAGG + Intergenic
959580033 3:107973897-107973919 CTTTGCCTAAAGAGAGAGGCTGG - Intergenic
959748277 3:109803377-109803399 CAGAGCCTGCAGATAGGAGCTGG - Intergenic
959990448 3:112625759-112625781 CTGTGGGTGCAGGGAGTAGCAGG + Intronic
960124028 3:113978091-113978113 ATGTGTCTGCAGAGATGAGCTGG - Intronic
960492331 3:118332933-118332955 CTGAGGCTGCATAGAGCAGCAGG - Intergenic
960727020 3:120680864-120680886 CTGAGTCTTCAGAGAGAAGTTGG - Intronic
961355991 3:126340363-126340385 CTGGGCCAGCTGGGAGAAGCAGG - Intergenic
961357323 3:126347324-126347346 CTCTGCCTACAGAGGGAAGGAGG + Intronic
961533475 3:127554786-127554808 GTGTGGCTCCAGAGAGGAGCTGG - Intergenic
961812906 3:129531997-129532019 CTGGGCATGCAGGGAGAGGCTGG + Intronic
962162360 3:133012941-133012963 CTGTGGCTGCACAGATCAGCAGG - Intergenic
962832937 3:139159971-139159993 CTTTGCCTGCAGAGGTCAGCTGG - Intronic
966405292 3:179591283-179591305 CTGTGGCTCCAGAGAGAGACAGG - Intronic
966978041 3:185103776-185103798 CTGCACCTGCAGAGATAAGCAGG + Intronic
968269814 3:197394733-197394755 CTGTGGCTAAAGACAGAAGCTGG - Intergenic
968361154 3:198147866-198147888 CTGTGCCTGGAGACAGACACTGG - Intergenic
968689574 4:1983745-1983767 CGGTGCCTGCAGGGGGATGCAGG - Intronic
968787122 4:2630918-2630940 CAGAGCCTGCACAGAGAAGAGGG - Exonic
970363901 4:15338637-15338659 CTGTGAATGCAGAGAAAAGATGG - Intergenic
970559976 4:17273143-17273165 CTGAGGCTGCAGAGAGAACAAGG + Intergenic
971277940 4:25215684-25215706 CTGAGGCTGCACAGAGCAGCAGG + Intronic
972101946 4:35431413-35431435 CTGAGACTGCACAGAGCAGCGGG - Intergenic
972359656 4:38315208-38315230 CTGTGCGTGAGGAGAGAGGCTGG + Intergenic
972839435 4:42913803-42913825 CTGAGGCTGTATAGAGAAGCGGG - Intronic
973369415 4:49233897-49233919 CTGTGCCTGCACCCAGACGCTGG + Intergenic
973391621 4:49561519-49561541 CTGTGCCTGCACCCAGATGCTGG - Intergenic
973817963 4:54635760-54635782 CTGAGCCTGGAGAGACAAGCAGG - Intergenic
974573681 4:63688951-63688973 CTGAGGCTGCAAAGAGCAGCAGG - Intergenic
974924243 4:68277826-68277848 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
976298152 4:83492723-83492745 CTGAGGCTGTAGTGAGAAGCTGG - Intronic
976616250 4:87080581-87080603 CTCAGCCTTCAGAGAGTAGCTGG - Intronic
978492480 4:109323534-109323556 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
979060919 4:116059380-116059402 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
979672975 4:123380941-123380963 GTGTGGCTGGAGAGAGAGGCAGG + Intergenic
980026836 4:127778221-127778243 CTGCACCTGCACAGATAAGCAGG + Intergenic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980660007 4:135845168-135845190 CTCTTCCTTCAGAAAGAAGCAGG + Intergenic
981356901 4:143799352-143799374 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981368432 4:143929949-143929971 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981378229 4:144040234-144040256 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981800506 4:148649736-148649758 ATGTGTCTGAAGAGAGAAGTTGG + Intergenic
982113316 4:152075778-152075800 CTGTCCCTGCTCAGGGAAGCAGG + Intergenic
982268710 4:153564880-153564902 CTGAGCCTGGAGGGAGAAGCTGG - Intronic
982283328 4:153708651-153708673 CTGTACCTGCACAGATAAGCAGG + Intergenic
983189505 4:164740113-164740135 CTGTGGCTCTAGGGAGAAGCTGG - Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
983923386 4:173371023-173371045 CGGTGCCAGCAGAGACCAGCAGG + Exonic
984046902 4:174812508-174812530 CTCTGCCTGGAGAGAGAAAATGG + Intronic
984842649 4:184082343-184082365 CTGGCCCTTCAGAGAGAAGCAGG - Intergenic
985531001 5:433836-433858 CTGTCCCTGCAGAGAAAAGACGG - Exonic
985907820 5:2854793-2854815 CTGGTCCTGCAGGGAGGAGCTGG - Intergenic
986331336 5:6718055-6718077 GTGTGCCTGCAGTGTGCAGCAGG + Intronic
986428904 5:7662494-7662516 CTGGCCATGCAGAGAGAGGCAGG - Intronic
986582307 5:9278649-9278671 CTGAGGCTGCACAGAGCAGCAGG - Intronic
986894336 5:12347375-12347397 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
987084671 5:14457517-14457539 CTGAGCCCACAGAGAGAAGCTGG + Intronic
987101383 5:14594412-14594434 GTGTGACTGCAGGGAAAAGCTGG - Intronic
988579825 5:32459082-32459104 CTGAGTCTGCACAGAGCAGCGGG + Intergenic
988905769 5:35787049-35787071 CTCTGCCTTCAGGGAGAAACTGG + Intronic
989520293 5:42393062-42393084 CTGAGGCTGCAAAGAGCAGCAGG + Intergenic
990213746 5:53508259-53508281 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
990622315 5:57573374-57573396 ATGTTCCAGCAGACAGAAGCAGG + Intergenic
990727842 5:58776084-58776106 GAGTTCCTGCAGAGAGAACCAGG - Intronic
990978521 5:61580241-61580263 CTGCAGCTGCAGAGAGAGGCAGG + Intergenic
991122514 5:63032528-63032550 CTGAGGCTGCACAGAGCAGCTGG - Intergenic
991136227 5:63185625-63185647 CTGAGGCTGCATAGAGCAGCGGG - Intergenic
993723124 5:91341332-91341354 GTGAGGCTGCAGAGAGAGGCAGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994592337 5:101789053-101789075 CTGAGGCTGCACAGAGCAGCGGG - Intergenic
995390948 5:111639862-111639884 CTGAGGCTGCACAGAGAAGGGGG - Intergenic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
996046779 5:118882775-118882797 CTGAGGCTGCACAGAGCAGCAGG + Intronic
996480936 5:123974066-123974088 CTGAGGCTGCACAGAGGAGCAGG + Intergenic
997807959 5:136938416-136938438 AGGTGCCTACAGAGAGAAACAGG + Intergenic
999719939 5:154392134-154392156 GTGGGCCTGCAGAGAGGGGCTGG - Intronic
999886160 5:155925411-155925433 TTGAGCCTGCAGAGAGAATGTGG - Intronic
1000103092 5:158035494-158035516 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1000126925 5:158254530-158254552 CTGAGACTGTGGAGAGAAGCTGG + Intergenic
1000718623 5:164678783-164678805 CTGTGGCTGCACACAGAAGCAGG - Intergenic
1001380439 5:171302818-171302840 GAGTGCCTGAAGAGAAAAGCAGG + Intergenic
1003825159 6:9944296-9944318 ATGTGTCTGCAGACAGAATCTGG - Intronic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004392798 6:15223422-15223444 CTGTTCCTGTTGAGAGAAACAGG - Intergenic
1005361158 6:25032329-25032351 CTGAGCCTGCAGAAAGAACCAGG - Intronic
1005486159 6:26301897-26301919 CAGTGGCTGGGGAGAGAAGCAGG - Intergenic
1006222737 6:32507690-32507712 ATGTCCCTGCAAAGAGGAGCTGG + Intergenic
1006610373 6:35291092-35291114 CTGCTCCTGGAGAGGGAAGCAGG + Intronic
1007649857 6:43412703-43412725 CTGAGCCTGCAGGGAGGAGGGGG - Intergenic
1009377961 6:62994669-62994691 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1010344962 6:74800475-74800497 CTGAGGCTGCACAGAGCAGCTGG - Intergenic
1014137248 6:117904723-117904745 CTGTGCCTGAAGAGAAATTCGGG + Intergenic
1014374804 6:120659394-120659416 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1016776524 6:147910420-147910442 CTGCGCCCGGAGAGAGTAGCAGG - Intergenic
1017056381 6:150439969-150439991 TTGTGCCTGCTGACAGATGCAGG - Intergenic
1018008133 6:159642301-159642323 CTGTGCCCACAGAGAGGGGCAGG + Intergenic
1018527444 6:164728760-164728782 CTGAGGCTGCATAGAGCAGCAGG - Intergenic
1018830120 6:167435615-167435637 ATGTGTCCGCAGAGAGAATCCGG + Intergenic
1019018111 6:168895164-168895186 CTGTGCCAGGACAGAAAAGCAGG - Intergenic
1019077376 6:169398526-169398548 CTGTCCCTGGATACAGAAGCAGG - Intergenic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019254533 7:40855-40877 CTGTGCCTGGAGACAGACACTGG + Intergenic
1019911068 7:4100789-4100811 CTGGGCCTGGAGAGGGAGGCTGG + Intronic
1020100343 7:5390794-5390816 CTGGGCCTGGAGAGAGACCCAGG - Intronic
1020101041 7:5394590-5394612 CCTCGCCTGCAGAGAGAAGTTGG + Exonic
1020255111 7:6498459-6498481 CTGGCCCTGCAGAGAGAACAGGG - Intronic
1021096300 7:16539661-16539683 CTGAGGCTGCACAGAGCAGCGGG - Intronic
1021500862 7:21330416-21330438 CTGAGCCTGCAGGGGGAAGGGGG + Intergenic
1022266425 7:28759753-28759775 CTGCGGCAGCAGAGAAAAGCTGG - Intronic
1023022088 7:36019602-36019624 CACTGTCTGCAGAGAGAAGGGGG - Intergenic
1024129157 7:46332773-46332795 AGGTGCCTGCAGGGAGAGGCAGG + Intergenic
1024397496 7:48886684-48886706 ATTTCCCTGCAGAGAGAAGAAGG + Intergenic
1024522789 7:50321354-50321376 CTGAGGCTGCAGTGAGAGGCTGG - Intronic
1024845431 7:53636537-53636559 CTGAGGCTGCACAGAGTAGCAGG - Intergenic
1024891629 7:54210621-54210643 CTCTGCTTGAAGAGAGAAGAGGG + Intergenic
1026285967 7:68963040-68963062 ATGAGCCTACAGAGAGAAACAGG - Intergenic
1027177691 7:75915147-75915169 AGGTGCCCGCAGAGAGCAGCCGG + Exonic
1027525896 7:79268122-79268144 CTGTGCTTGGAGGTAGAAGCAGG + Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029489961 7:100865803-100865825 CTGAGCCTGCAGACAGCACCAGG + Exonic
1030178705 7:106682136-106682158 CTCTGCCTGCCCAGAGAAGAGGG - Intergenic
1031258760 7:119489493-119489515 CTGAGGCTGCACAGAGAAGTGGG + Intergenic
1032689177 7:134265677-134265699 CTGTCCCAGCAGAGAGAAGGAGG - Intergenic
1034212191 7:149373506-149373528 CTGAGACTGCACAGAGCAGCAGG + Intergenic
1034452271 7:151143329-151143351 CTGTGGTTGCAGAGAGGAGAAGG + Exonic
1034530997 7:151696471-151696493 CTGGGCCTGCAGAGACGACCTGG - Intronic
1034555888 7:151850129-151850151 CAGTGTCTGCAGAAAGAAGCGGG + Intronic
1034988015 7:155529477-155529499 CTGAGCCTGCAGAGAGATCACGG - Intronic
1035122439 7:156579615-156579637 CTGTGCCTGCAGGGTGAGGAAGG + Intergenic
1035285850 7:157806863-157806885 CTGTGCATGCAGAGGAGAGCGGG - Intronic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1036439915 8:8773040-8773062 CTGTGCAAGCAGTGAGCAGCTGG + Intergenic
1036638578 8:10567914-10567936 CTCTGCCTTCAGCGAGAATCTGG + Intergenic
1036751977 8:11449340-11449362 CTGAGCCGGCAGAGAGGTGCTGG + Intronic
1037295691 8:17397480-17397502 CTCTGCCTGCAGAAAGGAGAGGG + Intronic
1037834600 8:22208656-22208678 ATGTGGCTGCAGAGAAAGGCTGG + Intronic
1040101999 8:43513719-43513741 CTGTGCCTGCACCCAGAAGCTGG - Intergenic
1040945933 8:52883928-52883950 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1041632107 8:60099790-60099812 CTGAGGCTGCAAAGAGAAGCAGG + Intergenic
1042412151 8:68477915-68477937 CTGAGGCTGCACAGAGCAGCAGG + Intronic
1042459578 8:69047672-69047694 CTGACTCTGCTGAGAGAAGCAGG - Intergenic
1042572814 8:70185059-70185081 CTGTGTCTGTAGAGAGAAACTGG - Intronic
1042864029 8:73341115-73341137 CCTTGCCTGCAGAGAGGGGCTGG - Intergenic
1043172343 8:76981022-76981044 CTGGGCCTGCAGTGTGCAGCTGG + Exonic
1043918641 8:85954793-85954815 GTGAGCCTGCAGAGAAAAGGAGG + Intergenic
1044295101 8:90518610-90518632 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1044326884 8:90868974-90868996 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1045258029 8:100546309-100546331 CTGAGGCTGCAGAGAGCAGCAGG - Intronic
1045296276 8:100874131-100874153 TCCTGTCTGCAGAGAGAAGCAGG - Intergenic
1045438946 8:102191017-102191039 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1047254995 8:123207700-123207722 CTGGGCCTGCGGAGGGCAGCAGG - Exonic
1047511768 8:125521091-125521113 CTTTGCCTGAAGAGGGAAGGAGG + Intergenic
1047725764 8:127682868-127682890 CTGAGCCAGAGGAGAGAAGCTGG - Intergenic
1048069770 8:131009267-131009289 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1048137382 8:131759590-131759612 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1048180411 8:132189257-132189279 GGGAGCCTGCAGAGAGCAGCTGG - Intronic
1048526224 8:135205568-135205590 CTGAGGCTGCACAGAGAAGCTGG - Intergenic
1048683442 8:136873490-136873512 CTGTGCTTACAGAGAGAGTCTGG + Intergenic
1049583157 8:143421776-143421798 CAGAGGCTGCAGGGAGAAGCTGG + Intronic
1049675458 8:143887022-143887044 CTGCGCCTGCACACAGAAGTAGG + Intergenic
1049684330 8:143933324-143933346 CTTTGCCTGCAGCCAGCAGCCGG + Exonic
1049732245 8:144184689-144184711 CTGAGCTGGCAGAGAGAAGGGGG + Intronic
1050069165 9:1792247-1792269 CTGGGAATGCAGAGAAAAGCAGG - Intergenic
1050643369 9:7692981-7693003 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1050674557 9:8037061-8037083 CTGAGGCTGCACAGAGGAGCAGG + Intergenic
1050917612 9:11157830-11157852 CAGGGCCTCTAGAGAGAAGCAGG + Intergenic
1050976860 9:11949783-11949805 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1050996895 9:12231982-12232004 CTGTGGCTGCACAGAGCATCAGG + Intergenic
1051126317 9:13809759-13809781 CTGTGGCTGCAGAAAGACCCAGG - Intergenic
1051450869 9:17195655-17195677 GCGTGCCTGGAGAGAGAATCGGG + Intronic
1052048613 9:23821963-23821985 CCGTGCCGGCAGGGAGATGCCGG + Intronic
1052339036 9:27347350-27347372 ATATGCCTGCACATAGAAGCAGG + Intronic
1052877277 9:33576294-33576316 CTGTGCCTGCACCCAAAAGCTGG - Intergenic
1053264279 9:36699140-36699162 CTGAGGCTGCACAGAGCAGCGGG + Intergenic
1053498725 9:38568100-38568122 CTGTGCCTGCACCCAGAAGCTGG + Intronic
1053662466 9:40293205-40293227 CTGTGCCTGCACCCAGAAGCTGG - Intronic
1053912920 9:42923380-42923402 CTGTGCCTGCACCCAGAAGCTGG - Intergenic
1054374595 9:64439430-64439452 CTGTGCCTGCACCCAGAAGCTGG - Intergenic
1054522144 9:66083079-66083101 CTGTGCCTGCACCCAGAAGCTGG + Intergenic
1054750354 9:68898783-68898805 CTGTGCCTACAGTGAGGAGGGGG - Intronic
1057161780 9:92894398-92894420 CTGTGCCTGCACCCAGAAGCTGG + Intergenic
1057678177 9:97152593-97152615 CTGTGCCTGCACCCAGAAGCTGG + Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059531520 9:115039744-115039766 CTGTCCATGCACAGTGAAGCAGG - Intronic
1059540989 9:115130127-115130149 CTGTGGCTGGCCAGAGAAGCTGG - Intergenic
1059720907 9:116959361-116959383 ATGTGACTGGAGAGAGAAGCAGG + Intronic
1059793480 9:117665564-117665586 CTGTACATGCAAAGAGTAGCAGG - Intergenic
1061136151 9:128735064-128735086 CTGTTCCTGCACATGGAAGCGGG + Intronic
1061397103 9:130349218-130349240 CTTTGCCTGCGGAGAGCAGGGGG + Intronic
1061705591 9:132450774-132450796 ATGTGGCTGCAGAGAGAGCCCGG + Intronic
1061956191 9:133962431-133962453 GTGTCCCTGCAGAGAGGAGCTGG + Intronic
1062099023 9:134718437-134718459 CTGTGGCTGCCCAAAGAAGCAGG - Intronic
1062246355 9:135569022-135569044 CAGGGCCTGCAGAGAGACCCTGG + Intergenic
1062313471 9:135952938-135952960 CTGCGCATGCAGAGAGTGGCCGG - Intronic
1062395586 9:136351337-136351359 CTGGGCCTGGAGGGAGGAGCAGG + Intronic
1062493777 9:136822081-136822103 CTGGGCCAGGAGAGAGGAGCCGG + Intronic
1062745866 9:138211698-138211720 CTGTGCCTGGAGACAGACACTGG - Intergenic
1185752921 X:2628411-2628433 CAGTGCATGGTGAGAGAAGCAGG + Intergenic
1186210896 X:7249501-7249523 CTGTTCCTGCTGATAGAAACAGG - Intronic
1187274356 X:17805243-17805265 ATGTGCCTGCAGAGGCATGCAGG + Intronic
1187902125 X:24035042-24035064 CAGAGCCTGCAGACTGAAGCTGG + Intergenic
1188061583 X:25607188-25607210 CTGGGCCTGAAGAGGGAGGCAGG - Intergenic
1188115630 X:26239044-26239066 CTGAGACTGCACAGAGCAGCAGG + Intergenic
1189011329 X:37048578-37048600 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
1189289757 X:39876822-39876844 CTGTTGATGCAGAGAGAAGCAGG + Intergenic
1189422867 X:40872143-40872165 GTGGGGCTGCAGAGAGAAGAAGG - Intergenic
1189869645 X:45368900-45368922 CTGAGGCTGCACAGAGTAGCTGG - Intergenic
1190437187 X:50437299-50437321 TTTTGCCTGCAGGGAGAAGTTGG - Intronic
1190437194 X:50437347-50437369 TTTTGCCTGCAGGGAGAAGTCGG - Intronic
1190437201 X:50437395-50437417 GTTTGCCTGCAGGGAGAAGTTGG - Intronic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1190480226 X:50870147-50870169 CTGTGCCTGCAGAGAGAGGCAGG + Intergenic
1190763756 X:53459029-53459051 CAGTACCTGCAGAGAGACACAGG + Intergenic
1192510159 X:71716672-71716694 CTCCGCCCGCAGAGAGGAGCTGG - Intronic
1192516538 X:71764881-71764903 CTCCGCCCGCAGAGAGGAGCTGG + Intronic
1192522620 X:71815342-71815364 CTCTGCCCCCAGAGAGGAGCTGG + Intergenic
1193265584 X:79464458-79464480 CTGTGCCTACAGTGATAAGGGGG - Intergenic
1193635384 X:83943889-83943911 ATGTGCCAGCAGAGTGATGCTGG + Intergenic
1194149837 X:90310080-90310102 CTGAGGCTGCATAGAGCAGCTGG + Intergenic
1194169454 X:90564080-90564102 CTGGGGCTGCACAGAGTAGCAGG - Intergenic
1194831223 X:98624549-98624571 AAGTGCCTGGAGAGAGAAGAAGG + Intergenic
1195072887 X:101297956-101297978 ATGTGCCTGCCGAGATAATCGGG + Intergenic
1195822051 X:108956411-108956433 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1196582574 X:117394178-117394200 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1197451910 X:126629436-126629458 CTGGGGCTGCATAGAGAAGAGGG + Intergenic
1197496752 X:127193451-127193473 CTGCACCTGCACAGATAAGCAGG + Intergenic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1198948413 X:142041025-142041047 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1199092568 X:143708872-143708894 CAGAGGCTGCAGAGAGCAGCGGG + Intergenic
1200459769 Y:3440876-3440898 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1200515696 Y:4141854-4141876 CTGGGGCTGCACAGAGTAGCAGG - Intergenic
1200528181 Y:4298388-4298410 CTGTGTCTGCATAGAGTACCAGG - Intergenic
1201312687 Y:12611230-12611252 CTGTACCTGCACAGATAAGCAGG - Intergenic
1201584203 Y:15542997-15543019 CTGTTCCTGCTGATAGAAACAGG - Intergenic