ID: 927220332

View in Genome Browser
Species Human (GRCh38)
Location 2:20701860-20701882
Sequence ATGGAGAAGCCAGATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927220332 Original CRISPR ATGGAGAAGCCAGATGAGGT TGG (reversed) Intronic
900944163 1:5820304-5820326 CTGTAGAGGCCAGATGATGTTGG + Intergenic
901137345 1:7006587-7006609 CTGGAGAACCCAGTTGAGGTGGG + Intronic
901475437 1:9486175-9486197 AAGGAGCAACCAGATGAGGTGGG - Intergenic
902729202 1:18357462-18357484 ATGGAGATGGGGGATGAGGTGGG + Intronic
903953928 1:27012205-27012227 ATGGAAAAGCCAGGTGGGGAAGG + Intronic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904897149 1:33825606-33825628 GTGGGGAAGCCAGATGATGCTGG - Intronic
905284136 1:36868285-36868307 AGGAAGAAGCCAGCTTAGGTGGG + Intronic
905415446 1:37800625-37800647 TTAGAGAAGACAGATGATGTGGG - Exonic
905585228 1:39111960-39111982 ATGGAGAAGAGAGATGTGTTAGG - Intronic
905941927 1:41870182-41870204 AGGGATCAGCCAGATGAGGATGG - Intronic
907704654 1:56821842-56821864 AGGGTGAAGGCAGAAGAGGTGGG + Intergenic
908365804 1:63422637-63422659 ACGGAGAAGCCTGATTAGGTAGG + Intronic
909576548 1:77183213-77183235 ATGGAGGACCCAGATGAAGCTGG + Intronic
911185856 1:94904452-94904474 ATGGAGAACACAGCTGAGGCAGG + Intronic
912176193 1:107160676-107160698 ATGCAGGAGCCAGATTAGATAGG - Intronic
912481671 1:109986063-109986085 ATGGAAAATCAAGATGTGGTTGG - Intronic
912680004 1:111723115-111723137 ATGGGGAAGGCACCTGAGGTGGG + Exonic
912719423 1:112007119-112007141 AGGGAGAAGCCAGTGGGGGTGGG - Intergenic
914919907 1:151839603-151839625 AAGGAGGAGCCAGAGGAGGCAGG - Intronic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
915600109 1:156917228-156917250 ATTTAGAAGCCAGCAGAGGTTGG + Intergenic
916411808 1:164553571-164553593 GTGAACAAGACAGATGAGGTTGG + Intergenic
917481773 1:175418425-175418447 ATGGAAAAGGCAGTTGAGGCCGG + Intronic
917853814 1:179085977-179085999 CTGGAGAAGCCTGGGGAGGTGGG + Intronic
919735584 1:200948239-200948261 ATGGAAAGGCCAGAAGAGGGGGG + Intergenic
920043212 1:203117230-203117252 GTAGAGCAGCCAGATGAAGTGGG + Intronic
920355698 1:205370622-205370644 ATTCAGAAGTCAGATGAGGCCGG - Intergenic
921263492 1:213404000-213404022 TAGGAGAAGGCAGATGAGGGAGG + Intergenic
921454870 1:215358564-215358586 ATGGAAAAGCCAGAACATGTGGG - Intergenic
921707932 1:218345625-218345647 GGGGAGAAGCCAGCAGAGGTTGG + Intergenic
922737960 1:227999521-227999543 GTGGAGATGCCAGAGGAGGGCGG - Intergenic
923843682 1:237704114-237704136 AGGTAGAAGCTATATGAGGTAGG + Intronic
1063191624 10:3700046-3700068 TTGGAGACGCCTGATGAGGCTGG - Intergenic
1063312576 10:4968409-4968431 ACGGATAAGAAAGATGAGGTAGG + Intronic
1063315357 10:4999155-4999177 ACGGATAAGAAAGATGAGGTAGG - Intronic
1063497829 10:6526682-6526704 GTAGAGAAGACAGACGAGGTGGG + Intronic
1064149482 10:12850537-12850559 TTGAATAAGCCAGATGAGGAAGG - Intergenic
1065261589 10:23929082-23929104 ATGCAGAGGCCAAATCAGGTAGG + Intronic
1068813358 10:61281648-61281670 AAGAAGAAGACAGATAAGGTAGG + Intergenic
1069827294 10:71262088-71262110 ATGGAGAAGCCAGCTCAGGCTGG - Intronic
1073070753 10:100791775-100791797 ATGGAGATGGCAGGTGAGGAGGG - Intronic
1073953504 10:108839209-108839231 ATGCAGGAGTCAGATGAGGGAGG - Intergenic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1076039497 10:127232040-127232062 ATGGAGAAGGCAGAAAAGGAGGG + Intronic
1077199485 11:1298368-1298390 ATGGAGAAGCCAGTCGGGGGAGG + Intronic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1079242031 11:18728258-18728280 ATGGAGAACCCAGAGGATCTAGG - Exonic
1080874547 11:36264164-36264186 ATGGAGAAGCCCGGGAAGGTGGG + Intergenic
1081101714 11:39010335-39010357 ATGGAGAAGCCAAAGGAAATAGG - Intergenic
1082670497 11:56030961-56030983 ATGATAAAGCCAGAAGAGGTGGG - Exonic
1082716475 11:56620046-56620068 AGTGAGAGGGCAGATGAGGTTGG + Intergenic
1083284686 11:61650928-61650950 ATTAAGAAGCCAGGTGAAGTAGG - Intergenic
1083713883 11:64564852-64564874 ATCGAGAACCCCCATGAGGTGGG - Intronic
1084463324 11:69308263-69308285 CGGGAGAGGCAAGATGAGGTTGG - Intronic
1086336884 11:85809951-85809973 ATGGAGCAGCCAGATAGAGTAGG - Intronic
1087547350 11:99601710-99601732 TTGGAGAACAGAGATGAGGTGGG - Intronic
1090233294 11:125126072-125126094 ATGGAGATACCAGAGCAGGTAGG + Intergenic
1090464488 11:126922246-126922268 ATGGAGGGGCCAGTTGAGGAGGG - Intronic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1093910473 12:24741682-24741704 GTGGAAAAGCCAGATGAGATGGG - Intergenic
1095345060 12:41140412-41140434 AAGCAGGGGCCAGATGAGGTAGG + Intergenic
1096761330 12:53844346-53844368 ATGGGGAAGGCAGCTGAGGTTGG + Intergenic
1097170130 12:57108101-57108123 AAGGAGAAGGAAGATGAGTTAGG + Intronic
1097327101 12:58289200-58289222 ATGGAGAGCTCAGCTGAGGTGGG + Intergenic
1097587527 12:61532123-61532145 ATGGAACAGTCAGATGAGTTTGG - Intergenic
1097770834 12:63582852-63582874 ATGGAGCAGGCAGAGGAGCTAGG + Intronic
1100021958 12:90079883-90079905 ATGCAGAATTCAGAAGAGGTAGG - Intergenic
1101887254 12:108676225-108676247 ATGGAGAAGTCTGAGGAGGTTGG + Intronic
1102437144 12:112933393-112933415 ATGAAGAGTCCAGCTGAGGTTGG - Intergenic
1103117349 12:118347637-118347659 TAGGATAAGCCAGAAGAGGTGGG - Intronic
1104637358 12:130446686-130446708 AGGGAGGAGAGAGATGAGGTTGG + Intronic
1105554270 13:21430824-21430846 AAGAAGAAGCCAGATCAGCTAGG - Intronic
1106548107 13:30747848-30747870 AGGGAGAAGCGACATGAGGGTGG - Intronic
1107585840 13:41847528-41847550 AGGGAGAAGGCTGAAGAGGTAGG + Intronic
1111572501 13:90105806-90105828 ATTGAGAAACCAGAGGAGGCTGG + Intergenic
1111968008 13:94880651-94880673 ATCAAGAAGCCACATGAGGCAGG + Intergenic
1112367888 13:98771465-98771487 CTGGAGTAGCCAGCAGAGGTGGG - Intergenic
1113090426 13:106612302-106612324 CTTGAGAAGCCAGAAGAGGTGGG - Intergenic
1114237442 14:20835166-20835188 AGGAAGAAGCCAGAAGTGGTTGG + Intergenic
1114556979 14:23567729-23567751 AGGCAGAAGCCAGGTGAGGCTGG - Exonic
1114978794 14:28135743-28135765 AGAGAGAAGCCACATGAGATAGG - Intergenic
1116964109 14:50997083-50997105 ATGGAGAATCCCGGTGAGGTGGG + Intronic
1119009642 14:70971574-70971596 GTAGAGAAGCCACATGAGGGTGG - Intronic
1119790245 14:77343457-77343479 ATGGAGGAGCCATCAGAGGTGGG + Exonic
1120111648 14:80564395-80564417 AAGGAGAAGCCATATGATATAGG + Intronic
1120541258 14:85753647-85753669 ATGGAGGAGCAAGTTGTGGTTGG + Intergenic
1120801040 14:88688853-88688875 GTGAAGAAGGGAGATGAGGTTGG - Intronic
1121472433 14:94165873-94165895 ATGGAGGAGCCTGAAGGGGTCGG - Intronic
1122254193 14:100464676-100464698 ATGGGGAGGGGAGATGAGGTAGG - Intronic
1123123283 14:105927922-105927944 AGACAGAAGCCAGGTGAGGTGGG - Intronic
1123405928 15:20019426-20019448 AGACAGAAGCCAGATGAGGTCGG - Intergenic
1123515258 15:21026074-21026096 AGACAGAAGCCAGATGAGGTCGG - Intergenic
1125512717 15:40301586-40301608 CTGGAGGAGCGAGATAAGGTCGG - Intronic
1127034281 15:54897624-54897646 ATTGAGAATCCAGCTGAGTTTGG - Intergenic
1127581089 15:60340046-60340068 CTGGAAGAGCCAGATAAGGTGGG - Intergenic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128352479 15:66900391-66900413 ATTGAGAAGCCAGATTATTTGGG + Intergenic
1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG + Intergenic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1129066820 15:72912093-72912115 AGGCAGAACCCAGATGGGGTGGG - Intergenic
1129306329 15:74666289-74666311 ATGTAGAATCCAGATTAGTTTGG - Intronic
1129321554 15:74777814-74777836 ATGGAGAAGAGAGGAGAGGTTGG - Intergenic
1129499298 15:76020186-76020208 ATAGAGAGGCCAGAGGAGATAGG - Intronic
1129615888 15:77098465-77098487 AGGGAGAAGTCTGATGGGGTTGG + Intergenic
1130751392 15:86716813-86716835 ATTGGGAATCCAAATGAGGTGGG + Intronic
1130957380 15:88637254-88637276 ATAGTGATGCAAGATGAGGTTGG + Intronic
1131829560 15:96345327-96345349 AAGGAGAAGCTAGATCAGTTTGG - Intergenic
1132075851 15:98819054-98819076 GTGGAGAAGGCAGATGGGGCAGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134017447 16:10898960-10898982 ATGGAGATGCCAGCAGAAGTTGG + Exonic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1134323361 16:13184144-13184166 ATTGAGAAGCCAGATGGTTTGGG + Intronic
1134838864 16:17384805-17384827 AAAGAGAAGTCAGATGAGTTTGG - Intronic
1135527960 16:23228369-23228391 ATGGAGAGGGCGGATGAGCTGGG - Intergenic
1135637683 16:24093057-24093079 ATGGAGAAGACAGAAAAGGAGGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1135875518 16:26196480-26196502 AAGCAGAAGCCTCATGAGGTTGG - Intergenic
1136427457 16:30178594-30178616 ATGGAGAAGGCGGAGGGGGTAGG + Intergenic
1138019547 16:53465843-53465865 ATGGAGGAGGCAGAGGTGGTGGG + Intronic
1138563020 16:57813384-57813406 AAGGAGAAGCCAGAGGATCTTGG + Intronic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1141283241 16:82647755-82647777 ATGGAAAAGCCAGAAGAGACAGG + Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143358503 17:6348934-6348956 ATGGAGGAGTCAGCTGGGGTTGG - Intergenic
1143475914 17:7203892-7203914 TTGGAGCAGCCAGAGGAGGAAGG + Intronic
1143495999 17:7312927-7312949 AAGGAAAAACCAGATGATGTGGG + Intronic
1143608784 17:8005825-8005847 ATAGAGAAGCCTGATAAGATCGG + Intronic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144733336 17:17541164-17541186 ATAGAGCACCCATATGAGGTAGG + Intronic
1145909523 17:28534526-28534548 ATGGCCAAGCCAGGTGAGGCCGG + Exonic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1149078182 17:52622100-52622122 AAGCAGAACCCAGATGATGTAGG + Intergenic
1149628219 17:58095638-58095660 ATGGAGGAGTCAGATTAGGCAGG - Intergenic
1151728572 17:75898115-75898137 GAGGAGAAGCCACATTAGGTAGG - Intergenic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1157737819 18:50066013-50066035 ATGCAGAAGCCAGATCCAGTAGG + Intronic
1157762725 18:50276051-50276073 ATGGTGATGCCAGCTGATGTAGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158267520 18:55676724-55676746 ATGGAAATTCCAGATGAGATTGG + Intergenic
1158406592 18:57165452-57165474 ATGGAGGAGGGAGGTGAGGTGGG - Intergenic
1158740732 18:60139334-60139356 GTAGAAAAGCCAGTTGAGGTTGG - Intergenic
1158980549 18:62756465-62756487 ATTGAGAATCCAGAAGTGGTTGG + Intronic
1159681783 18:71362970-71362992 ATGGAGAAGTCAGAATATGTGGG - Intergenic
1160102410 18:75935350-75935372 ATGGAGAAGTGAGATCAGGAGGG + Intergenic
1160116090 18:76080986-76081008 CTGGAGAAGCAACATGAGTTGGG + Intergenic
1160355178 18:78221639-78221661 ATGGCAAATCCAGATGAGGAAGG - Intergenic
1161958002 19:7506866-7506888 AGGGAGAAGCCAGAGGAAGGGGG - Intronic
1162991491 19:14305539-14305561 ATAGAAAAGCCAGAAGAGGTCGG - Intergenic
1163095857 19:15056479-15056501 ATGCAGGAGCCAGCAGAGGTTGG - Exonic
1163717382 19:18880021-18880043 AAGGATAAGCCAGGTGAGGTGGG - Intronic
1165082928 19:33320605-33320627 AAGTAGAAGCCAGATGTGGAAGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166317301 19:41996355-41996377 ATGGGGAAGCCTGGGGAGGTGGG + Intronic
925370349 2:3340322-3340344 AAGGAGAAGCCAGATATGGCCGG + Intronic
925619415 2:5776478-5776500 ATGGAGGAGTCAGATGAGCTTGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927500503 2:23579769-23579791 TTGGTGAAGCCAGAAGAGGTGGG - Intronic
928219953 2:29395360-29395382 CTGGAGGAGCCTGGTGAGGTGGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
932840202 2:75074746-75074768 ATGGAGAAGGCAGTTGTGTTTGG + Intronic
933211222 2:79571556-79571578 ATGGAGAAGAAAGATCAGTTAGG - Intronic
933316326 2:80719913-80719935 TTGGATAAGCCAGATAAGGAGGG + Intergenic
933421383 2:82050214-82050236 ATGGAGAAGTAAGATCAGGTAGG + Intergenic
936607848 2:113975747-113975769 ATGGAGAAGGGAGACCAGGTAGG + Intergenic
937345799 2:121124565-121124587 CTGGAGAAGCCAGATGGGCCAGG + Intergenic
937535059 2:122876100-122876122 ATGGAGAAGATAGAGGAGGGTGG - Intergenic
937576859 2:123434116-123434138 AGGTAGAAGCCAGATCATGTAGG + Intergenic
938307019 2:130263489-130263511 ATGGAGAAGGGAGATGAGTGAGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
940887158 2:159000099-159000121 AGGGAGTAGCCAGGTGAGGTGGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941910721 2:170762135-170762157 ATGGGGTAGCAAGTTGAGGTTGG - Intergenic
941941306 2:171041407-171041429 GTGGGGAATCCAGATGTGGTGGG - Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
943390361 2:187259604-187259626 ATGGAGAAGCCAGAAAAAGCTGG + Intergenic
945007117 2:205420480-205420502 ATGGAAAAGCAAGGTGATGTAGG - Intronic
948959010 2:241316846-241316868 AAGGAGAAGGCAGTTAAGGTGGG - Intronic
1168851821 20:982127-982149 GTAGAGCAGCCAGATGAGTTCGG + Intronic
1168999467 20:2157063-2157085 ATGGAGAAGACACATGTGTTAGG + Intronic
1169464340 20:5824095-5824117 AGGGAGAAGCCAGATCCTGTGGG - Intronic
1170111310 20:12807076-12807098 ATTAAGAAGCCACATGTGGTTGG - Intergenic
1171100357 20:22377264-22377286 ATGGAGAATTCAGATGACATGGG - Intergenic
1171158578 20:22899813-22899835 GTGGAGAAGAGAGATCAGGTAGG + Intergenic
1171431423 20:25085203-25085225 ATGGAGCAGCCAGAGGTGGGAGG - Intergenic
1171992635 20:31708497-31708519 CTGGAGAAGCCAGCTGTGGCTGG + Intronic
1172034198 20:32000234-32000256 ATAGAGGAGTCAGATGAGGGAGG + Exonic
1172111120 20:32545597-32545619 ATGGAGAAGCCTGCTGGGGGAGG - Intronic
1172312882 20:33931872-33931894 AGGGTGAAGCCAGGTGGGGTGGG + Intergenic
1174052675 20:47778244-47778266 ATGTGGAAGCCAGATGTGTTAGG - Intronic
1174188457 20:48723271-48723293 CTGGAGAAGCCAGAGGGGGTGGG + Intronic
1174875363 20:54221821-54221843 ATGGAAAAGCCATTTGAGGTAGG + Intronic
1175121231 20:56717633-56717655 GTGGATATGCCATATGAGGTGGG + Intergenic
1176379633 21:6105607-6105629 ATGGATGAGCCAGGTCAGGTGGG + Intergenic
1178581113 21:33839422-33839444 AGGGAGGAGCCAGATGGAGTGGG + Intronic
1178632745 21:34276979-34277001 ATGGAGACACCAGATGGGGCAGG + Intergenic
1178722280 21:35020634-35020656 ATGCAGCAGCCAGGTGACGTTGG - Intronic
1178918511 21:36723018-36723040 AAGCAGGAGCAAGATGAGGTTGG - Intronic
1179743841 21:43432630-43432652 ATGGATGAGCCAGGTCAGGTGGG - Intergenic
1180942686 22:19669807-19669829 AGGGACAACCCAGATGAGGAAGG + Intergenic
1181435837 22:22910345-22910367 ATGGCGAGGCCTGAGGAGGTTGG - Intergenic
1181910055 22:26231445-26231467 ATTGAGAATCAAGCTGAGGTAGG - Intronic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182156595 22:28079228-28079250 AAGGAGAAGACAGATAAGATAGG + Intronic
1183334300 22:37237852-37237874 AAGGAGCAGCAAGATGAAGTCGG + Intronic
1183577262 22:38700163-38700185 ATTGAGAAGAGAGAAGAGGTGGG - Exonic
1183600714 22:38838874-38838896 ATGGAAAAGACAGGTGAGCTGGG - Intronic
1183650650 22:39151760-39151782 TTGAAGAAGGCAGATGGGGTAGG + Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184396666 22:44246077-44246099 CTGGAGCAGCCAGGTGAGGCGGG + Exonic
1185073490 22:48669907-48669929 ATGGAGAAGCCAGCTCAGGCGGG - Intronic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949355149 3:3172547-3172569 CTGGAGATGGGAGATGAGGTTGG + Intronic
949820386 3:8109804-8109826 ATAGAGAGGCAAGATGATGTAGG + Intergenic
951929154 3:27944160-27944182 ATGGAGAATCCAGTTGAGTAGGG + Intergenic
953382157 3:42480154-42480176 ATGGAGTGGGCAGATGAGGAGGG + Intergenic
953387710 3:42516122-42516144 ATGGTGAGGCAAGATGAGGTGGG - Intronic
954959858 3:54554625-54554647 CTGTAGAAGCCAGATGAGAGCGG - Intronic
956202098 3:66717323-66717345 ATGGAGAAGACAGGTGATTTGGG + Intergenic
960855553 3:122098672-122098694 ACGGAGCAGGCAGATGAGTTAGG + Intronic
961462108 3:127057226-127057248 GTGGAGAAGTCAGATGCTGTTGG + Intergenic
961674774 3:128558036-128558058 ACGGTGGAGCCAGATGGGGTGGG - Intergenic
962271140 3:133978843-133978865 GCCGAGAAGCCAGAGGAGGTGGG - Intronic
962960465 3:140306725-140306747 CTGGAAAAGCCACATGATGTGGG - Intronic
963296006 3:143547536-143547558 ATGGAGAGCCCAAATGAGGTGGG - Intronic
963646004 3:147915490-147915512 GGAGAGAAGCCAGTTGAGGTTGG - Intergenic
965141500 3:164841857-164841879 ATGGGGAAGCCTGAGGAGATGGG - Intergenic
965541890 3:169879513-169879535 ATGTAGAAGCCAGATTGTGTGGG + Intergenic
965697876 3:171428181-171428203 AAGGAGAAGGGAGATGAGTTCGG + Intronic
965925207 3:173970506-173970528 ATGTGGAAGCCAGATGATGAAGG + Intronic
967129424 3:186457064-186457086 ATGGAGAAGCCACATGGAGAGGG + Intergenic
968064041 3:195748244-195748266 AAGCAGCAGCCAGATCAGGTGGG + Intronic
968075031 3:195811706-195811728 ATGGAGACAGCAGATGAGGCTGG - Intronic
968135261 3:196216121-196216143 CTGGAAAAGCCAGATGAGGCCGG - Intronic
973820944 4:54660752-54660774 GTGGTGAAGCCTGATGAGATTGG + Intronic
975547416 4:75573968-75573990 ATGGAGAAGCCAGTTCTGCTTGG - Intergenic
976478806 4:85514951-85514973 ATGCAGAAGCCAGATAGGGAAGG + Intronic
977145048 4:93429203-93429225 ATGGAGAAGCCAGATGGCAAAGG + Intronic
977346552 4:95823754-95823776 ATGGTAAAGCCCGATGAGTTAGG + Intergenic
979286090 4:118926192-118926214 AGGCAGAGGCCAGATTAGGTAGG + Intronic
982298005 4:153849666-153849688 ATAAAGAAGCCAGAAGATGTGGG - Intergenic
982348769 4:154391613-154391635 GTTGAGATGTCAGATGAGGTTGG - Intronic
984367341 4:178816241-178816263 ATTGAGAAGCGAGATGTGATAGG - Intergenic
985303556 4:188514714-188514736 AAGGAGAAAGCAGGTGAGGTGGG - Intergenic
986224388 5:5799664-5799686 ATGGTGAAGCCAGCTGTGCTGGG - Intergenic
986857881 5:11892290-11892312 ATCGAGAAGACAAATAAGGTAGG - Intronic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988949245 5:36241341-36241363 AGGGAGAAGCCAGAGGACCTGGG + Intronic
991013335 5:61906708-61906730 CTGCAGAAGCCAGGTGAGGTGGG + Intergenic
991100665 5:62789055-62789077 ATGAAGAAGTCAAAGGAGGTAGG + Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992076391 5:73196456-73196478 AAGGAGTGGCCAGATAAGGTTGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
995039781 5:107574478-107574500 ATGGAGAAGCCAGAGGTTGTTGG - Intronic
997023101 5:130025426-130025448 CAGGAGGAGCCAGATCAGGTGGG + Intronic
998401674 5:141851782-141851804 ATGGAGAAGCCAGAAGAAAGAGG - Intergenic
999296537 5:150462959-150462981 AGGGAGAAGGGAGATGAGGTGGG + Intergenic
999400074 5:151257689-151257711 ATGAGGGACCCAGATGAGGTTGG - Intronic
1000592348 5:163173616-163173638 ATAGAGAAGCCTTATGAGGGAGG - Intergenic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001710701 5:173775723-173775745 ATGCAGCACCCAGATGAGGCAGG + Intergenic
1001836183 5:174834689-174834711 ATGCAGAAAAGAGATGAGGTTGG - Intergenic
1006364807 6:33609055-33609077 ATGGAGACACCAGATGAGTGAGG - Intergenic
1006704047 6:36001804-36001826 ATGGAGAAGCCAGAATGGGGAGG + Intronic
1006721333 6:36153734-36153756 AGGAAGAAGCCAGATGAGAGCGG - Intergenic
1006807209 6:36796451-36796473 ATGGAGATGCCCTATGAGGGAGG - Intronic
1007349191 6:41256202-41256224 AGGTAGAAGCCAGCTGAGGTGGG - Intergenic
1007702774 6:43774222-43774244 TTGGAGAAGCCAGAGGCTGTTGG + Intronic
1007738233 6:43995115-43995137 TTGGAGAAGCCAGTTGCAGTGGG + Intergenic
1007794882 6:44339297-44339319 ATGGTGAGGCCAGAGGAGGGTGG - Intronic
1008686536 6:53931545-53931567 ATGAAGAATACAGATGAGGTTGG - Intronic
1011069776 6:83367624-83367646 ATGGTGAAGCTAGTAGAGGTTGG - Intronic
1011206593 6:84905849-84905871 ATTGAGAAGAGAGATGAGATTGG + Intergenic
1013683939 6:112556695-112556717 ATGAAGAACACAGATGAAGTTGG - Intergenic
1014861800 6:126478035-126478057 CTGGTGAAGCCAGAGGAAGTTGG - Intergenic
1015150588 6:130032609-130032631 ATGGTGAAGACAGATGAGATAGG - Intronic
1015272703 6:131353810-131353832 ATGGGGAAGCTAGACGATGTTGG + Intergenic
1015526318 6:134177582-134177604 ATGGGGAAGGCACATAAGGTGGG - Intronic
1015815461 6:137206434-137206456 ATGGAGACGCCAGAGAAAGTAGG + Intronic
1019078536 6:169411510-169411532 ATGGACAGGCCACACGAGGTGGG - Intergenic
1019511209 7:1418543-1418565 ATAGTGAAGTCAGATGAGGGTGG - Intergenic
1020120246 7:5499170-5499192 ATGGAGGAGACAGGAGAGGTCGG - Intronic
1021027747 7:15688757-15688779 ATAGAGAAGCTACATGAGTTGGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022930316 7:35105083-35105105 ATGGAGCAGGCAGAGGAGCTAGG + Intergenic
1023487012 7:40698284-40698306 AGGGTGAGGCCAGAAGAGGTAGG + Intronic
1023925526 7:44666696-44666718 CAGGACAAGCCAGATGAGGAGGG - Intronic
1024213481 7:47227340-47227362 ATGGAGATGCCCTAGGAGGTGGG - Intergenic
1024610309 7:51058722-51058744 ATGGAGAGGCGTGATGAGGCAGG + Intronic
1024818777 7:53303073-53303095 ATGCAGAGGACAGATTAGGTAGG + Intergenic
1024995629 7:55271399-55271421 AAGGAGAGGCCAGGAGAGGTGGG - Intergenic
1026062932 7:67042544-67042566 ATAGAGAAGGAAGATGGGGTAGG + Intronic
1026503657 7:70964048-70964070 ATGGAGAAGTGAGATGATATGGG - Intergenic
1026522599 7:71130605-71130627 ATGGAGTATCCAGTTGAGTTGGG - Intergenic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1026715417 7:72784946-72784968 ATAGAGAAGGAAGATGGGGTAGG - Intronic
1027531290 7:79336842-79336864 AAGGAGAAGACAGAAGATGTAGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1029826206 7:103197634-103197656 ATGGAGCAGGCAGAGGAGGCAGG + Intergenic
1031445456 7:121847984-121848006 ATGCAGAAGGCTGATGAGATAGG + Intergenic
1036036783 8:5028701-5028723 ATGAAGCAACCAAATGAGGTGGG - Intergenic
1037681598 8:21102149-21102171 ATGGAGGAGTGAGATGACGTTGG - Intergenic
1039048457 8:33471889-33471911 AAGGAGAAGCCAGAGGCGATTGG - Intronic
1039775053 8:40727356-40727378 ATGCAGAAGCCAACTGAGGTGGG - Intronic
1040044506 8:42948659-42948681 ATGGAGAAACCAGCATAGGTAGG - Intronic
1041182919 8:55267043-55267065 ATGGAGAAATCTGATGGGGTTGG + Intronic
1041931843 8:63295598-63295620 GTGGAGAAACCAGCTGAGGCTGG - Intergenic
1043448069 8:80338987-80339009 ATTGAGTATCCAGGTGAGGTAGG - Intergenic
1043457217 8:80424641-80424663 ATTGAGCAACAAGATGAGGTAGG - Intergenic
1044362538 8:91305022-91305044 ATTCAGAAGCCCTATGAGGTAGG - Intronic
1044846985 8:96391711-96391733 GTGGAGAATCCAGATGAGAGAGG + Intergenic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1045390187 8:101707442-101707464 ATACAGCAGCCAGATGAGGATGG - Intronic
1045686755 8:104720610-104720632 ATGGAGAAGTCAGTTGAGATGGG + Intronic
1045834863 8:106507965-106507987 AAGAAGAAGCCAGAGGAGGCTGG - Intronic
1046875293 8:119248448-119248470 AAGGAGAAGTAAGATTAGGTAGG + Intergenic
1047297122 8:123580989-123581011 ATGGAGAAGGAAGAGCAGGTGGG + Intergenic
1048926411 8:139276466-139276488 CTGGAGAAAGCAGAGGAGGTGGG + Intergenic
1049304465 8:141893576-141893598 ATAGAGAAGCCAGATGGTGAGGG - Intergenic
1050013827 9:1211960-1211982 ATGGAGAACTCAGTTCAGGTTGG - Intergenic
1051895248 9:21979788-21979810 CTGGAGAACCCAGCTGAGGGTGG + Intronic
1052736136 9:32344556-32344578 AGGCAGAAGGCAGATGAGGGAGG - Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054473743 9:65558486-65558508 AAGGAGAAGGCAGGGGAGGTGGG - Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1055423073 9:76163681-76163703 AGGGAGAAGCCAGGTGGGCTTGG + Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1056395102 9:86174744-86174766 ATGAACAAGACAAATGAGGTGGG - Intergenic
1056708100 9:88968829-88968851 GTGGAGTAGCCAGATGAGGGAGG + Intergenic
1056804321 9:89716707-89716729 AGCGAGAAGCCACATGAGTTTGG - Intergenic
1057548885 9:96037807-96037829 AAGGAGGAGCCAGAGGAGATGGG + Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057858310 9:98619821-98619843 ATGAAAAAGCCAGGTGAGGAAGG + Intronic
1058070047 9:100592436-100592458 ATGGAGAAGCTAGGTTCGGTGGG - Intergenic
1058794503 9:108484685-108484707 AATGGGAAGCCAGGTGAGGTTGG - Intergenic
1059116887 9:111607888-111607910 ATGTAGAAGGCATTTGAGGTTGG - Intergenic
1059900684 9:118921798-118921820 AGGGAGAAATCAGATGAGGTGGG - Intergenic
1061119895 9:128636034-128636056 GTGGAGAGGCCAGAAGAGGCAGG - Intronic
1061809845 9:133155869-133155891 ATGGAGAGGCCTGATGGGGGCGG - Intronic
1185505169 X:627841-627863 TTGGAGAAGACAGCTGAGCTGGG + Intronic
1187480158 X:19648081-19648103 ATAGAGAAGGCAGATGTGTTTGG - Intronic
1187877445 X:23816029-23816051 TTGGGGAAGCCAGATAAGATGGG - Intergenic
1188290496 X:28381872-28381894 ATGAAGAAGTCATTTGAGGTCGG - Intergenic
1191021226 X:55862498-55862520 ATGGAGAATCCAGGAGAGGCAGG + Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1198778553 X:140208253-140208275 AAGGAGAAACCAGATCAGGTAGG + Intergenic
1199221957 X:145327074-145327096 ATGGAGTTGGGAGATGAGGTTGG + Intergenic
1199913546 X:152314513-152314535 AGGCAGAAGCCAGATCATGTGGG - Intronic