ID: 927229224

View in Genome Browser
Species Human (GRCh38)
Location 2:20803450-20803472
Sequence GCACTGCTGTTTACAGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927229224_927229228 -4 Left 927229224 2:20803450-20803472 CCCCAAGCTGTAAACAGCAGTGC 0: 1
1: 0
2: 0
3: 7
4: 168
Right 927229228 2:20803469-20803491 GTGCTCTAGATTGCTACACAGGG 0: 1
1: 0
2: 0
3: 2
4: 53
927229224_927229227 -5 Left 927229224 2:20803450-20803472 CCCCAAGCTGTAAACAGCAGTGC 0: 1
1: 0
2: 0
3: 7
4: 168
Right 927229227 2:20803468-20803490 AGTGCTCTAGATTGCTACACAGG 0: 1
1: 0
2: 0
3: 4
4: 39
927229224_927229231 24 Left 927229224 2:20803450-20803472 CCCCAAGCTGTAAACAGCAGTGC 0: 1
1: 0
2: 0
3: 7
4: 168
Right 927229231 2:20803497-20803519 TCTCCAACTTGCAATTCCAGTGG 0: 1
1: 1
2: 0
3: 9
4: 145
927229224_927229229 -1 Left 927229224 2:20803450-20803472 CCCCAAGCTGTAAACAGCAGTGC 0: 1
1: 0
2: 0
3: 7
4: 168
Right 927229229 2:20803472-20803494 CTCTAGATTGCTACACAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927229224 Original CRISPR GCACTGCTGTTTACAGCTTG GGG (reversed) Intronic
902685304 1:18072820-18072842 GCTCTGCTGATCACAGGTTGGGG - Intergenic
903393951 1:22984947-22984969 AGAATGCTGTTTACAGCTTTGGG - Intergenic
903975058 1:27144226-27144248 ACAGTGCAGTTTACGGCTTGAGG + Intronic
904297805 1:29533137-29533159 GCCCTGCTGGCTACAGCTTCTGG - Intergenic
905545815 1:38799570-38799592 GCACATCTGTTTATAGCATGTGG - Intergenic
910715513 1:90225444-90225466 CCACTGCTGTGTGCAGCTTAGGG + Intergenic
911638025 1:100257641-100257663 TCACTGCAGCTTCCAGCTTGTGG + Intergenic
912223232 1:107701408-107701430 CCACTGCTGTGTGCAGCTTAAGG - Intronic
915305976 1:154978799-154978821 GGACAGCTGTGTAAAGCTTGAGG - Exonic
915714324 1:157930345-157930367 GCTCTGTCTTTTACAGCTTGTGG - Intergenic
917489421 1:175485300-175485322 TCAAAGCTGTTTACAGTTTGGGG - Intronic
919151436 1:193705561-193705583 ACACTTCTGTCTTCAGCTTGGGG - Intergenic
922499195 1:226084028-226084050 GCACTGTTTTTTCCAGCTCGCGG - Intergenic
924541865 1:244988399-244988421 ACACTGCTGTTTATATTTTGTGG + Intronic
924845747 1:247768252-247768274 GAACTGCAGTTTACAGTATGTGG - Intergenic
1063822439 10:9853455-9853477 GCAGTGCTGAGTGCAGCTTGTGG - Intergenic
1064393559 10:14961422-14961444 GCATTGCTGTTTCCTGTTTGTGG + Intronic
1064481754 10:15746872-15746894 GGACTGGTGGTCACAGCTTGGGG - Intergenic
1065840700 10:29698196-29698218 GGACAGCTGTGTAAAGCTTGAGG - Intronic
1067328137 10:45289230-45289252 AAACTGCTGAGTACAGCTTGAGG + Intergenic
1069323063 10:67197640-67197662 GCACTGCTGTTTAAGGATTGTGG + Intronic
1069560374 10:69424983-69425005 GCACTGCATTTTACATCTTGGGG + Intergenic
1069601351 10:69710170-69710192 GCCCTGCTGCTTACAGCCTCTGG - Intergenic
1073706655 10:105990711-105990733 GCACTGGTGTTTGCAGGCTGCGG - Intergenic
1074148497 10:110738312-110738334 CCACTGCTGCTTACAGGCTGGGG + Intronic
1077054657 11:585204-585226 ACACTGCCCTTTCCAGCTTGAGG + Intronic
1077669780 11:4146713-4146735 GCACTGCTGAGCATAGCTTGTGG - Intergenic
1078914982 11:15770607-15770629 GGACTGCTGTTCATAGCCTGGGG - Intergenic
1079445908 11:20555943-20555965 CCCCTGCTGTGTACAGCCTGAGG - Intergenic
1081802878 11:45871743-45871765 GCCCTGCTCTTTGCTGCTTGGGG + Intronic
1081934374 11:46894928-46894950 GTACTGATGCTGACAGCTTGGGG - Intronic
1084001709 11:66298900-66298922 GCTCTGCTGTCTTCAGCATGTGG - Intergenic
1084086857 11:66858858-66858880 GCACTGCTGTTCCCACCATGGGG - Exonic
1085918214 11:80918010-80918032 TCACTGCTGTGTTCAGCTGGTGG + Intergenic
1086112042 11:83209660-83209682 GGACAGCTGTGTAAAGCTTGAGG - Intronic
1088689211 11:112311070-112311092 GATCTGCTGGTTACAGCCTGGGG + Intergenic
1090029976 11:123197836-123197858 CCAGTGCTGTTTATTGCTTGAGG + Intergenic
1092246801 12:6868279-6868301 GCTTTGCTGTTTCCAGGTTGGGG - Intronic
1092533432 12:9364275-9364297 CCACTGCTGCTTACAGGCTGGGG + Intergenic
1094472675 12:30818017-30818039 GCTCTGCTGTCTTCAGCTGGAGG + Intergenic
1096542279 12:52314550-52314572 GTGCTGCTGTTTTCAGCTGGTGG + Exonic
1096648088 12:53048986-53049008 GGGCTGCTGTCCACAGCTTGGGG + Exonic
1100824816 12:98464680-98464702 ACATTGCTGTTTGCAGCCTGTGG - Intergenic
1101137698 12:101762387-101762409 GCACTGTTGTATACTGTTTGTGG + Intronic
1104185342 12:126425268-126425290 CCACTGCTGCTTACAGGCTGGGG + Intergenic
1104888571 12:132127135-132127157 GCACAGCTTTTTACTGCTGGTGG - Intronic
1105209507 13:18249656-18249678 GCACTGCTGTTGCCAGGTAGGGG + Intergenic
1105617529 13:22032872-22032894 TCACTGCTATTTACAATTTGTGG + Intergenic
1107198133 13:37679847-37679869 GCACTGCATTTTAGAGCTGGTGG + Intronic
1107443596 13:40449945-40449967 GCACTGCTGTTTTTAGACTGTGG - Intergenic
1107621510 13:42236162-42236184 GCACTGATTTATACAACTTGTGG - Intronic
1111170652 13:84522411-84522433 CCACTGCTGCTTACAGGCTGGGG - Intergenic
1112888756 13:104206873-104206895 GCACAGGTGCTTACAGCTGGAGG - Intergenic
1114363583 14:22002983-22003005 GCGCTGCTGCCTTCAGCTTGTGG + Intergenic
1117162459 14:53002611-53002633 GCTCTGCTGTTTATAACTGGTGG + Intergenic
1117844929 14:59900888-59900910 TCACTGCTGCTTACAGGCTGGGG - Intergenic
1125743933 15:41986449-41986471 GCTCTGCTGCTTACCACTTGGGG + Intronic
1129151951 15:73694730-73694752 ACACTGATGTGTACAGCTTCTGG - Intronic
1131237175 15:90706698-90706720 CCACTTCTATTTACAGCCTGGGG - Intergenic
1133698501 16:8287556-8287578 CCACTGCTGCTTACAGGCTGGGG + Intergenic
1136372117 16:29843001-29843023 GCCCTGCTGTTTGCAGCCTGTGG + Intronic
1137026302 16:35478930-35478952 GCAGTGCTGTTTCTAGCTTTGGG + Intergenic
1137529085 16:49265555-49265577 GCTCCGCTGTCTACAGCTTTGGG + Intergenic
1142774281 17:2124016-2124038 GCACTCCTGTGTACAGCTCAAGG + Intronic
1143544575 17:7588747-7588769 GCACGGCTGTTTTCCTCTTGGGG + Intronic
1143651326 17:8265772-8265794 GCACTGCTATTCCCAGCATGTGG - Intronic
1146797342 17:35791993-35792015 GGACTGCTGTGTTCTGCTTGAGG + Intronic
1149390282 17:56182961-56182983 GCACATCTGTTTACAGCATACGG + Intronic
1149974010 17:61247935-61247957 GCACTTGTGGTTACAACTTGCGG + Intronic
1150657824 17:67051842-67051864 GCACAGCTGTTTGCACCTGGTGG - Intronic
1152869234 17:82743131-82743153 GCACGGCTGGGTGCAGCTTGTGG + Intronic
1154427480 18:14283279-14283301 CCACTGCTGTGTACAGCCTCAGG + Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1156089849 18:33454179-33454201 ACACAGCAGTTTACAGCTTCAGG + Intergenic
1159557419 18:69959924-69959946 GCACTGCTGGTTACTTCTAGAGG - Intronic
1160322748 18:77911749-77911771 GCACGTCTGTTTACAGCTCTGGG + Intergenic
1160452683 18:78976523-78976545 GCAATGTTGTTTTCATCTTGAGG - Intergenic
1161083877 19:2325019-2325041 GCCCTGCTGCTTAGGGCTTGCGG + Intronic
1161155582 19:2730717-2730739 CCACTGCTGTTGGAAGCTTGGGG - Intronic
1161671588 19:5614619-5614641 GCATTGCAGCTTTCAGCTTGGGG - Intronic
1165120874 19:33557589-33557611 GCAGTGCTGTATAAATCTTGAGG - Intergenic
1165285310 19:34837393-34837415 TCACTGCTGCTTACAGGCTGGGG + Intergenic
1165775594 19:38402912-38402934 GCACTGCAATTTACAGCTCCAGG + Intergenic
925002829 2:420024-420046 GCACTGCTGCGCACAGCCTGTGG + Intergenic
925309400 2:2871658-2871680 GCACTGCTGCCTGCGGCTTGGGG - Intergenic
925485399 2:4323248-4323270 GCACTGGTGTTTAGGGCTTCAGG + Intergenic
927229224 2:20803450-20803472 GCACTGCTGTTTACAGCTTGGGG - Intronic
927387202 2:22548477-22548499 TCACTGATGATTACTGCTTGTGG + Intergenic
928292106 2:30048579-30048601 GCAATGCTGTTTACACAGTGAGG - Intergenic
929159106 2:38813853-38813875 GCATTGCTGATATCAGCTTGGGG + Exonic
932129558 2:69175547-69175569 TCACTGCAGTTTCCAGCTTCTGG - Intronic
932472754 2:71973047-71973069 ACACTGTTGTTCACAGCTAGTGG - Intergenic
934044919 2:88164903-88164925 GCAGTGCTGCTTACAGAGTGGGG + Intergenic
936684611 2:114813001-114813023 GTACAGCTGTATACAGCGTGTGG + Intronic
938075196 2:128328547-128328569 GCACTGCCATTTACTGCTTATGG - Intergenic
938911944 2:135893949-135893971 GCACTGCTGCACCCAGCTTGGGG - Intergenic
941342293 2:164322348-164322370 ACTCTGCTGTTTCCAGTTTGGGG + Intergenic
942748268 2:179260928-179260950 AAACTGCTGTTGACAGTTTGAGG - Intronic
947154897 2:227152611-227152633 ACACTGCTGTTTACAGTGTCAGG - Intronic
947683699 2:232061524-232061546 CTACTGCATTTTACAGCTTGTGG + Intronic
1174560494 20:51427625-51427647 GCACTGCTGCTGAAAGCCTGCGG + Intronic
1174569738 20:51492941-51492963 GCATTGGAGTTTGCAGCTTGGGG + Intronic
1175362099 20:58420487-58420509 GCACTGCTATTTGAAGCTAGTGG + Intronic
1176102221 20:63369765-63369787 GCACTGCCTTTTTCAGCCTGTGG + Intronic
1177236153 21:18392020-18392042 CCACTGCTGTGTACAGCCTTGGG - Intronic
1177599201 21:23288982-23289004 CCACTGCTGTGTACAGCCTCAGG + Intergenic
1184544955 22:45161564-45161586 CCACTGCTGCTTACAGGCTGGGG - Intergenic
1185232911 22:49693616-49693638 GCACAGCTGTCTGCAGCTGGAGG - Intergenic
950207315 3:11091226-11091248 GGACGTCTGTTTACAGCTCGGGG + Intergenic
950314941 3:11993398-11993420 GCACATTTGTTTACAGCATGAGG - Intergenic
955000295 3:54921072-54921094 AATCTGCTGATTACAGCTTGAGG + Intronic
958710195 3:97708737-97708759 CCACTGCTCTGTACAGCCTGAGG + Intronic
965607784 3:170513840-170513862 GCCATTCTGTTGACAGCTTGTGG - Intronic
965809732 3:172579216-172579238 CCACTGCTGTGTGCAGCTTTGGG + Intergenic
969983467 4:11182459-11182481 ACACTGGGGTTTAGAGCTTGTGG - Intergenic
973134268 4:46686504-46686526 GCACTGCTCTTTAGAGTTAGAGG - Intergenic
975965262 4:79965326-79965348 ACACAGCTGTTTTCAGGTTGTGG - Intronic
976070074 4:81231242-81231264 GCACTGCTCTGTGCAGCTTCAGG + Intergenic
977756382 4:100676671-100676693 CCACAGCTGCTTACAGCCTGGGG - Intronic
977835677 4:101643434-101643456 TCACTGCTGTTTACTGTTTGGGG + Intronic
978370346 4:108023686-108023708 GGATTGCTCTTTACAGCATGTGG - Intronic
978957337 4:114630616-114630638 GTACTTCTGTTTCCATCTTGGGG + Intronic
981606442 4:146545931-146545953 GCACTGCTGGTGTCAGCTGGGGG + Intergenic
987544755 5:19299754-19299776 GCAATACTTTTTAAAGCTTGAGG - Intergenic
989552085 5:42747347-42747369 GCACTGCTATTTTCACCTTCTGG - Intergenic
990347972 5:54887691-54887713 ACACTGCTGTGGACAGCTGGAGG - Intergenic
990995256 5:61726703-61726725 ACCCTGCGGTTCACAGCTTGTGG - Intronic
991073416 5:62512199-62512221 GGACAGCTGTGTAAAGCTTGAGG + Intronic
992119088 5:73572661-73572683 GTACACCTGTTTACTGCTTGAGG + Intronic
995170335 5:109103567-109103589 CTATTTCTGTTTACAGCTTGAGG + Intronic
995247270 5:109948439-109948461 GCACTGCTGTATGCTGATTGTGG + Intergenic
996967488 5:129322565-129322587 GCACTACTGTTAGCAGCTTGAGG + Intergenic
997298166 5:132782691-132782713 ACACTGCTGCTTACAGATTATGG - Intronic
997619293 5:135274397-135274419 GCTCTGCTGTTTACTGGCTGTGG + Intronic
998558173 5:143146381-143146403 GAACTGCCTTTCACAGCTTGTGG - Intronic
1000934631 5:167293054-167293076 ACAGTGCTGGTTTCAGCTTGTGG + Intronic
1002813168 6:654005-654027 GCACATCTGTTTACAGCATCTGG + Intronic
1003047656 6:2748741-2748763 GCTCTGCTGTCTACCGCGTGAGG + Intronic
1006204876 6:32331744-32331766 CCACTGCTGCTTACAGGCTGGGG - Intronic
1007242720 6:40438706-40438728 GCACTTGTGTTTCCTGCTTGGGG + Intronic
1011738292 6:90334112-90334134 CCCCTGCTGTGTGCAGCTTGGGG - Intergenic
1016675570 6:146763085-146763107 GCACTGCTGTTCACTACTTTGGG + Intronic
1019018107 6:168895142-168895164 GCAGCGCTGTTTACAGAATGGGG - Intergenic
1019663486 7:2239385-2239407 GCACTGCTGTTGGCACCTTCTGG - Intronic
1019898716 7:4002955-4002977 GCAGTGCTGTTTGCAGCTCATGG + Intronic
1020051241 7:5083130-5083152 ACACTGGTGTTTATGGCTTGGGG + Intergenic
1021705744 7:23365843-23365865 GGACAGCTGTTCACAGATTGTGG - Intronic
1023190675 7:37577733-37577755 GCACTTCTGTTTTCTCCTTGGGG + Intergenic
1023549079 7:41349843-41349865 CAACTGCTGTTAACACCTTGTGG + Intergenic
1027487806 7:78783741-78783763 GCACTGCTGTCTACAAACTGGGG - Intronic
1030016684 7:105229778-105229800 GCACTGCTGTGTTCAGCCAGAGG + Intronic
1031618584 7:123909084-123909106 GCACAGATGTTTCCAGTTTGAGG - Intergenic
1037465007 8:19151380-19151402 GCACTGCAGCCTACAGCATGAGG + Intergenic
1037745601 8:21641782-21641804 GCACTGTTGCTTCCAGTTTGGGG + Intergenic
1037950913 8:23018312-23018334 GCACTGCTTTTTATAGGGTGGGG + Exonic
1040845860 8:51838412-51838434 TCACCGTAGTTTACAGCTTGTGG - Intronic
1040955779 8:52978360-52978382 GCTCTGCTAATTACACCTTGTGG + Intergenic
1041284023 8:56242068-56242090 CCACTGCTGTTTTCAGCCTTCGG - Intergenic
1043480174 8:80644889-80644911 GGACAGCTGTGTAAAGCTTGAGG + Intronic
1045885213 8:107087811-107087833 GCTTTGCTGTTTACAGCTAAGGG + Intergenic
1047482768 8:125300638-125300660 GCACTGAAGTTTACAGTCTGTGG + Intronic
1047677108 8:127214356-127214378 GCACTGCGTTTTACAAATTGTGG - Intergenic
1049782186 8:144434148-144434170 GGAGTGCTGTGTGCAGCTTGAGG + Exonic
1051453356 9:17223189-17223211 GCACTGCAATTTAAAGCTTATGG + Intronic
1051822226 9:21181484-21181506 GCACTGCTGGTGTAAGCTTGGGG - Intergenic
1051827260 9:21234140-21234162 GCACTGCTGGTGTAAGCTTGGGG - Intronic
1052791897 9:32882974-32882996 TCACTGGAGTTTACTGCTTGGGG + Intergenic
1052983559 9:34467738-34467760 TTACTGCTGTTTACAGTGTGAGG - Intronic
1055508377 9:76970798-76970820 GCACTGCTGTTGACTGCCTGGGG - Intergenic
1192055609 X:67769950-67769972 GCACTGCTGTTGTGAGCTTGGGG - Intergenic
1192556193 X:72091522-72091544 GCACTCCTATATACAGCTAGTGG - Intergenic
1194838388 X:98710034-98710056 GCACTGCTGGCAAGAGCTTGGGG + Intergenic
1195573431 X:106422532-106422554 GAAATGCTTTTTTCAGCTTGAGG + Intergenic
1199674947 X:150180808-150180830 CCACTGCTGTTCTCACCTTGAGG - Intergenic
1199678582 X:150208148-150208170 GGGCTGCTATTTGCAGCTTGGGG - Intergenic
1201523964 Y:14910360-14910382 GCACTGATGATTCCAGATTGGGG + Intergenic