ID: 927229302

View in Genome Browser
Species Human (GRCh38)
Location 2:20804200-20804222
Sequence TAGGATGTTCAATCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927229302_927229310 14 Left 927229302 2:20804200-20804222 CCCTGCCCAGATTGAACATCCTA 0: 1
1: 0
2: 1
3: 15
4: 128
Right 927229310 2:20804237-20804259 TTGGCTAGGTTGTAGTGAAATGG 0: 1
1: 0
2: 34
3: 481
4: 7130
927229302_927229307 -5 Left 927229302 2:20804200-20804222 CCCTGCCCAGATTGAACATCCTA 0: 1
1: 0
2: 1
3: 15
4: 128
Right 927229307 2:20804218-20804240 TCCTAAGGCAAATGCAATGTTGG 0: 1
1: 0
2: 1
3: 3
4: 140
927229302_927229311 15 Left 927229302 2:20804200-20804222 CCCTGCCCAGATTGAACATCCTA 0: 1
1: 0
2: 1
3: 15
4: 128
Right 927229311 2:20804238-20804260 TGGCTAGGTTGTAGTGAAATGGG 0: 1
1: 0
2: 14
3: 383
4: 3391
927229302_927229309 0 Left 927229302 2:20804200-20804222 CCCTGCCCAGATTGAACATCCTA 0: 1
1: 0
2: 1
3: 15
4: 128
Right 927229309 2:20804223-20804245 AGGCAAATGCAATGTTGGCTAGG 0: 1
1: 0
2: 2
3: 11
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927229302 Original CRISPR TAGGATGTTCAATCTGGGCA GGG (reversed) Intronic
900853586 1:5163031-5163053 TAGGATGTTCTGGCTGGGCATGG - Intergenic
900983524 1:6059961-6059983 TGGGATGTGCGCTCTGGGCAAGG + Intronic
902313810 1:15602686-15602708 TAGGATTTTCAATCTAGAAACGG - Intergenic
905167291 1:36090164-36090186 TATCATTTTCAATCTGGGTATGG + Intronic
907151935 1:52297132-52297154 TAGGTAGTTCAACCAGGGCAAGG - Intronic
907665975 1:56434206-56434228 TAGAATGTTGACTCTGAGCATGG + Intergenic
908371611 1:63485919-63485941 TAGCATGCTAAGTCTGGGCAGGG - Intronic
911080142 1:93920703-93920725 TAGAATTTTCAATGTGGGCAGGG - Intergenic
911618568 1:100040748-100040770 AAAAATGTTCAGTCTGGGCACGG - Intronic
911854815 1:102863102-102863124 CCGGATGTGCCATCTGGGCAGGG + Intergenic
915588095 1:156855493-156855515 TAGGATGTTCAGGCCGGGCGTGG - Intronic
916952813 1:169798123-169798145 TCGGAAGTACAAACTGGGCATGG + Intronic
919178743 1:194054877-194054899 TAATATGTTAAAGCTGGGCATGG + Intergenic
920624558 1:207584420-207584442 TAGGATGCTTAATTTGGGAAAGG + Intronic
923630346 1:235645505-235645527 AAGAATGTTCAGGCTGGGCATGG + Intronic
923745448 1:236695570-236695592 GAAGGTTTTCAATCTGGGCAGGG - Intronic
1065065947 10:21964500-21964522 TAAAATTTTGAATCTGGGCATGG - Intronic
1069078485 10:64063619-64063641 TAGGATGGTCAATGTGTGGACGG + Intergenic
1069618548 10:69821928-69821950 TAGCATTTGCAAGCTGGGCAGGG - Intronic
1071921159 10:90352076-90352098 TAGCATGCTCAAGCTGGGAAAGG + Intergenic
1074784455 10:116826826-116826848 TTGGATGTTTAATCTGTGCCAGG + Intergenic
1075717377 10:124564704-124564726 TAGGATGTTGAGTCTGGGCTGGG + Intronic
1076637870 10:131894202-131894224 TAGGATGTGCAATCTTTCCATGG - Intergenic
1078436235 11:11328056-11328078 AAGGCTGTTTAAACTGGGCATGG + Intronic
1078504010 11:11916156-11916178 AAGGATGTGCAGGCTGGGCATGG + Intronic
1080539201 11:33250457-33250479 TTGGATGTTCAGGCTGGGCGTGG + Intergenic
1081750325 11:45505999-45506021 GAGACTGTTCACTCTGGGCAGGG + Intergenic
1087493355 11:98857165-98857187 TAGGATATTCCATTTGGTCATGG - Intergenic
1088354474 11:108927927-108927949 CAAGATGTTCCAGCTGGGCACGG - Intronic
1089071330 11:115701691-115701713 TAGGAAGTGCAGGCTGGGCAGGG - Intergenic
1089216098 11:116835620-116835642 TAAGACGTCCAGTCTGGGCACGG + Intergenic
1093393417 12:18651303-18651325 TAGGGTGTTCAAGGTAGGCAGGG - Intergenic
1101207901 12:102507271-102507293 ATGAATCTTCAATCTGGGCAAGG + Intergenic
1101573584 12:105977582-105977604 AAGGATGGTCAATATTGGCATGG - Intergenic
1105829676 13:24152741-24152763 TTGGATGGTCACTCTGAGCAAGG + Intronic
1106833461 13:33610240-33610262 AAGGAGGTTCACTCTGGGGAGGG + Intergenic
1111131733 13:83985754-83985776 TACCATAATCAATCTGGGCAAGG - Intergenic
1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG + Intergenic
1118959528 14:70516223-70516245 TAGGATTTTACATCTTGGCAAGG + Intergenic
1119630083 14:76222659-76222681 TAAGAAGTTGAATCTGGGCTGGG + Intronic
1119840026 14:77785426-77785448 TAGGAGGGTCCAGCTGGGCATGG - Intergenic
1119964074 14:78893482-78893504 TATAATGTTCAAACTGGGGAGGG + Intronic
1120074114 14:80136240-80136262 TTGGATTTTCACTCTGGGCCAGG + Intergenic
1126779156 15:52123831-52123853 TAGCCTGTTTAAGCTGGGCATGG - Intronic
1130663898 15:85853284-85853306 GAGGGTGTTGAGTCTGGGCAGGG - Intergenic
1131040897 15:89265851-89265873 TAGGATGTTCATTCTGTGCCAGG + Intronic
1135721703 16:24823221-24823243 GAGGAAGTTCGCTCTGGGCAAGG + Intronic
1142657624 17:1404356-1404378 TAAGATCTTCAATCTGGGCCAGG - Intergenic
1142682494 17:1558591-1558613 TAGGCTGTGCAATCTGCTCAAGG + Intronic
1144435222 17:15233996-15234018 TAGAATGATCACTCTGGCCATGG + Intronic
1148236992 17:45975617-45975639 TAGAGTTTTCATTCTGGGCAGGG - Intronic
1150837379 17:68576587-68576609 GAGGGTGCTCAGTCTGGGCAGGG + Intronic
1152737259 17:82003652-82003674 TTGGATGTAAAATTTGGGCATGG + Intronic
1154180936 18:12139352-12139374 AAGAATGTTGAAGCTGGGCACGG + Intergenic
1161462628 19:4407655-4407677 TAGGATGTTGAAGCGGGGCATGG + Intronic
1162723708 19:12677146-12677168 TGGGATGATCATTCTGGGCGGGG - Exonic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1167092606 19:47354957-47354979 TTAGATTTTCAATTTGGGCAGGG + Intronic
927229302 2:20804200-20804222 TAGGATGTTCAATCTGGGCAGGG - Intronic
930377913 2:50590944-50590966 TAACATTTTCAATCAGGGCAGGG - Intronic
931788710 2:65644381-65644403 TATGTTGCTCACTCTGGGCATGG + Intergenic
932744326 2:74319687-74319709 TAGGATGTTCAATCAGTGAATGG - Intronic
940715399 2:157217834-157217856 AAGGATTTTCAGCCTGGGCATGG + Intergenic
943381826 2:187159036-187159058 TAGCATCTTCATTCTGGGAAGGG + Intergenic
1170294257 20:14806822-14806844 TGGGAAGTTCGAACTGGGCAGGG + Intronic
1170298859 20:14859872-14859894 TAGAATGTTAAATCAGGACAGGG + Intronic
1172369361 20:34375970-34375992 TAAGATGTTCAGTCTGCACATGG - Intronic
1172474675 20:35227362-35227384 GAGGATGTTCAAGCTGGAGAAGG + Intronic
1173948381 20:46969777-46969799 CTGGATGTTAAACCTGGGCAAGG + Intronic
1175033474 20:55977546-55977568 TAGGATTTACTATCTGGGCACGG + Intergenic
1176118983 20:63445682-63445704 TAGGGGGTTCTATCTGGGCTAGG + Intronic
1177565115 21:22810641-22810663 TAGTATATTCCAGCTGGGCATGG + Intergenic
1178397462 21:32254773-32254795 GAGGCTGTTAAATCTGGGCCCGG - Intergenic
1182390019 22:29985885-29985907 TATGATATTAAATTTGGGCACGG + Intronic
1183490326 22:38112336-38112358 TAGGATGCTCAGGCTGGGCAGGG + Intronic
950276518 3:11665953-11665975 TAGAAAGTTCATTCTGGGCCGGG + Intronic
951459458 3:22933679-22933701 TGGGATGTTTAACCTGAGCAAGG - Intergenic
954042745 3:47901867-47901889 TAGGATATTCAAGCCAGGCATGG + Intronic
957604581 3:82380909-82380931 TTGGAAATGCAATCTGGGCAGGG - Intergenic
958441934 3:94165592-94165614 TAGAAAGTTCACTCTAGGCAGGG - Intergenic
961157529 3:124692876-124692898 CAGGCTGTACAATCTGGACATGG + Intronic
963087293 3:141450029-141450051 TAGGATGTACAAACTAGGGAGGG - Intergenic
967080273 3:186043353-186043375 AAGGATCTTACATCTGGGCAAGG - Intergenic
967258403 3:187617253-187617275 CAGGATTTTCATTCTTGGCATGG + Intergenic
970114869 4:12683698-12683720 TAGCTTCTTCACTCTGGGCATGG - Intergenic
970868932 4:20791951-20791973 TAGTAGGTCCAATATGGGCAGGG - Intronic
971542198 4:27833237-27833259 TAGGATGTTAAGGCTGGGCACGG + Intergenic
972848315 4:43017160-43017182 TGGCATGTTCATTCTGGGCGTGG + Intronic
973775728 4:54239590-54239612 TAGCAAGTTGAATCTGGGCAAGG - Intronic
977284817 4:95089661-95089683 TGTTATCTTCAATCTGGGCATGG - Intronic
981023030 4:140048733-140048755 TACGATTTTCAGTCTTGGCAGGG - Intronic
982183393 4:152771379-152771401 TAGGAGGTTGAATGTGTGCATGG - Exonic
987310605 5:16678049-16678071 TAGGATTTTTCAGCTGGGCATGG - Intronic
987771354 5:22309849-22309871 TAAGATGTTTAATTTGGGAAGGG + Intronic
988471111 5:31539750-31539772 GAGCATGTTCAGGCTGGGCATGG + Intronic
989194185 5:38700016-38700038 TGGGAAGTTCAAACTGGGTACGG + Intergenic
989619812 5:43373089-43373111 AAGAATGTTCAGGCTGGGCATGG - Intergenic
990974007 5:61541521-61541543 TGGAATGTTAAATCTGGGGAGGG + Intronic
993990334 5:94648768-94648790 GAGGCTGTTCAGGCTGGGCACGG - Intronic
996285564 5:121787125-121787147 TAGGATGTTCATTATGGGAGTGG - Intergenic
996373001 5:122773220-122773242 TAGGATCTTCAATCTGAGGTTGG + Intergenic
1002045060 5:176536982-176537004 TAGGACGGCCAAACTGGGCAGGG + Exonic
1004506339 6:16249891-16249913 TAGGATGGTCCTTCTGGGCAGGG + Intronic
1004937236 6:20519583-20519605 TAAGAAGTTCACTCTGGGCCGGG + Intergenic
1007721659 6:43888800-43888822 GAGGATGGTGGATCTGGGCATGG - Intergenic
1007774736 6:44218765-44218787 TAGAAAGTGCAGTCTGGGCAGGG + Intergenic
1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG + Intergenic
1011776772 6:90739517-90739539 TAGGAAGTTCAGACTGGGCGGGG - Intergenic
1012083050 6:94785198-94785220 CAGGAAGTTCAAACTGGGCGGGG - Intergenic
1013505422 6:110795259-110795281 CAGGAAGTTTAAGCTGGGCATGG - Intronic
1014038219 6:116792697-116792719 CAGGATGATGACTCTGGGCAAGG + Exonic
1015694715 6:135967204-135967226 TATGGTGTACAATCTGGGGAAGG - Intronic
1016318421 6:142815587-142815609 TATGAATTTCAAGCTGGGCATGG + Intronic
1016445171 6:144124603-144124625 TAGGGTGATCATTCTGGGGAAGG + Intergenic
1018114613 6:160571633-160571655 TAGGAAGTTTGAACTGGGCAGGG - Intronic
1019015340 6:168875990-168876012 CTGGATCTTCCATCTGGGCAGGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1026304762 7:69131233-69131255 TTGAATGTGCAATTTGGGCAGGG + Intergenic
1026935285 7:74251302-74251324 TCTGAGGTTCAAACTGGGCATGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028574431 7:92331202-92331224 TAGGATGTGGACTCTGGTCAGGG + Intronic
1028662518 7:93296014-93296036 AAAGATGGTCAAGCTGGGCATGG - Intronic
1028727093 7:94100697-94100719 TAGCATGTGTAATCTGTGCATGG - Intergenic
1029296809 7:99546803-99546825 TAGGATTTTCAATCTTGACACGG - Exonic
1033071474 7:138207247-138207269 TAAGATGTTAAGGCTGGGCATGG - Intergenic
1035515627 8:230041-230063 TAAAAAGTTAAATCTGGGCAGGG + Intergenic
1041412440 8:57571676-57571698 TATGATGTTCACTCTGGTAAGGG - Intergenic
1043449318 8:80350501-80350523 TAGGATCATTAATCTGGGCCAGG - Intergenic
1043959976 8:86406175-86406197 GAGGATGTTCAATTTGTCCAAGG - Intronic
1045804381 8:106140112-106140134 AAGAATGTTCATTCTGGGCCGGG - Intergenic
1047551445 8:125877213-125877235 TAAAAAGTTCTATCTGGGCATGG + Intergenic
1048431785 8:134377562-134377584 TTGAATGAACAATCTGGGCATGG - Intergenic
1051923857 9:22299452-22299474 TAGGCTGTTCAGTCTGGGAATGG + Intergenic
1052125114 9:24765157-24765179 CAGGAAGTTCAAACTGGGCAGGG - Intergenic
1053250044 9:36566786-36566808 TTGGATGTAAAATCTGTGCATGG + Intergenic
1055729002 9:79261531-79261553 TAGGAGGTGCAGTGTGGGCAAGG - Intergenic
1056784844 9:89583331-89583353 AAGGATGTTTTCTCTGGGCATGG - Intergenic
1060335440 9:122717589-122717611 TAGAATTTTAAATCTGGGAAGGG + Intergenic
1061119584 9:128634840-128634862 TAGGCTGTTCATTCTGGGCACGG - Exonic
1188001366 X:24985601-24985623 TAGGATATTCAACCTGTACAAGG - Intronic
1188793882 X:34439108-34439130 TAGGAGGTTCAGTCTTGGGAGGG - Intergenic
1190491616 X:50988391-50988413 TAGGATGTGATATCTGGACAGGG - Intergenic
1195068039 X:101254980-101255002 AAGGATCTTCAGTCGGGGCAAGG + Intronic
1197784536 X:130187074-130187096 TGGGATGTTCCATCTGGGAGAGG - Intergenic
1201922206 Y:19245689-19245711 GAGGAAGTTCAAACTGGACAGGG + Intergenic