ID: 927229760

View in Genome Browser
Species Human (GRCh38)
Location 2:20810788-20810810
Sequence TCCGCCTCATGTTAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2018
Summary {0: 1, 1: 5, 2: 256, 3: 876, 4: 880}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927229756_927229760 27 Left 927229756 2:20810738-20810760 CCAGGCCACATAGCAGGAGATAA 0: 2
1: 6
2: 73
3: 409
4: 791
Right 927229760 2:20810788-20810810 TCCGCCTCATGTTAGATCAGTGG 0: 1
1: 5
2: 256
3: 876
4: 880
927229758_927229760 22 Left 927229758 2:20810743-20810765 CCACATAGCAGGAGATAAGCGGC 0: 1
1: 3
2: 17
3: 199
4: 863
Right 927229760 2:20810788-20810810 TCCGCCTCATGTTAGATCAGTGG 0: 1
1: 5
2: 256
3: 876
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927229760 Original CRISPR TCCGCCTCATGTTAGATCAG TGG Intronic
Too many off-targets to display for this crispr