ID: 927231111

View in Genome Browser
Species Human (GRCh38)
Location 2:20825073-20825095
Sequence CTGCCTTTCAGATGCTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 10, 3: 85, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927231108_927231111 25 Left 927231108 2:20825025-20825047 CCCTTAATTTGCCTGTAATTAAA 0: 2
1: 77
2: 211
3: 319
4: 629
Right 927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG 0: 1
1: 1
2: 10
3: 85
4: 281
927231109_927231111 24 Left 927231109 2:20825026-20825048 CCTTAATTTGCCTGTAATTAAAA 0: 2
1: 86
2: 210
3: 343
4: 666
Right 927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG 0: 1
1: 1
2: 10
3: 85
4: 281
927231107_927231111 26 Left 927231107 2:20825024-20825046 CCCCTTAATTTGCCTGTAATTAA 0: 2
1: 75
2: 189
3: 326
4: 511
Right 927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG 0: 1
1: 1
2: 10
3: 85
4: 281
927231110_927231111 14 Left 927231110 2:20825036-20825058 CCTGTAATTAAAAATGATTATAA 0: 1
1: 0
2: 5
3: 70
4: 728
Right 927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG 0: 1
1: 1
2: 10
3: 85
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927231111 Original CRISPR CTGCCTTTCAGATGCTACTC TGG Intergenic
900935609 1:5764626-5764648 CTGCCTTGCAGCGGCTGCTCGGG - Intergenic
901527958 1:9835923-9835945 CTGCCTTTCCCAGGCTGCTCCGG - Intergenic
902268078 1:15283037-15283059 TTGTCTTTGAGCTGCTACTCTGG - Intronic
902749065 1:18494040-18494062 TTGCCTCTGAGCTGCTACTCTGG - Intergenic
902781400 1:18707288-18707310 CTGACTTTCAGATCCTGCTCTGG + Intronic
902913009 1:19614981-19615003 CTGCCTTTCTGAGACAACTCAGG + Intronic
902966515 1:20008477-20008499 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
904407844 1:30305084-30305106 CTGCCTCTGAGCTGCTATTCTGG + Intergenic
904455985 1:30648384-30648406 CAGCCTTTGATCTGCTACTCTGG - Intergenic
904714391 1:32456331-32456353 CTGCCTCTGAGCTGCTATTCTGG + Intergenic
904718351 1:32486465-32486487 CTGCCTCTGAGCTACTACTCTGG - Exonic
905039035 1:34937992-34938014 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
905588000 1:39136648-39136670 TTGTCTCTCAGAAGCTACTCAGG + Intronic
907569005 1:55465949-55465971 CTGCCTTTCAAAGTCAACTCAGG - Intergenic
910479050 1:87638641-87638663 TTGCCTCTGAGCTGCTACTCTGG + Intergenic
911409805 1:97488884-97488906 CTGCCTCTCAGCTGCTGCTCTGG + Intronic
912717932 1:111995041-111995063 CTGACTTTCAGAAGCTCCACTGG - Intergenic
912971399 1:114287004-114287026 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
913232196 1:116749345-116749367 CTGCCTTTAAGCTGATACTCTGG - Intergenic
915132645 1:153706455-153706477 TGGCCTTTGAGCTGCTACTCTGG + Intergenic
916005799 1:160658897-160658919 CTGCCTCTGACCTGCTACTCTGG - Intergenic
916648148 1:166809279-166809301 TTGCCTCTGAGCTGCTACTCTGG + Intergenic
918026029 1:180747307-180747329 CTGGCTTTCAGAAGGTGCTCAGG + Intronic
918584614 1:186171417-186171439 CTGCCTTTGAGCTGATACCCAGG - Exonic
918794311 1:188873304-188873326 CTGCCTCTGGGTTGCTACTCTGG + Intergenic
919365813 1:196659534-196659556 CTGCCTCTGAGCTGCTACTGTGG - Intronic
919748161 1:201021421-201021443 TTGCCTTTCAGTTGCTGATCTGG - Intronic
920063416 1:203245804-203245826 CTGCCTCTGAGCTGCTATTCTGG - Intronic
920606755 1:207396389-207396411 CTGCCTCTGAGCTGCTATTCTGG - Intergenic
920883327 1:209900300-209900322 CTGCATTTTAGCTGCTACTGTGG - Intergenic
921753834 1:218829213-218829235 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
922221451 1:223611483-223611505 CTGCCTGTCAGCTGCTACTGTGG + Intronic
923485754 1:234429506-234429528 CTGCCGTTCAGATGCCAATAAGG - Exonic
1063746636 10:8891102-8891124 CTGCCCCTGAGCTGCTACTCTGG - Intergenic
1064456794 10:15494885-15494907 CTGCCTTTCAGATGACACTGAGG + Intergenic
1064540738 10:16402860-16402882 CGGCCTCTGAGCTGCTACTCTGG - Intergenic
1064655333 10:17550608-17550630 CTACCTTTGAGCTGCTACTCTGG - Intergenic
1065593996 10:27294643-27294665 ATGTCTTTTAGATGCCACTCAGG - Intergenic
1067265793 10:44743896-44743918 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1067492501 10:46724520-46724542 CTGCCATGCAGATGCAACTAAGG + Intergenic
1067602167 10:47615874-47615896 CTGCCATGCAGATGCAACTAAGG - Intergenic
1068691502 10:59920403-59920425 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1070184884 10:74051962-74051984 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1070196303 10:74160374-74160396 CTGCTTCTGAGCTGCTACTCTGG + Intronic
1070572341 10:77649921-77649943 CTTTCTTTCAAATGCTAATCTGG + Intergenic
1072264289 10:93712739-93712761 TCGCCTTTGAGCTGCTACTCTGG + Intergenic
1073127232 10:101158960-101158982 CTGCCTCTGAGCTGCCACTCTGG + Intergenic
1073891792 10:108111055-108111077 CTGCCTCTGAGTTGCTACTCTGG - Intergenic
1073893390 10:108125230-108125252 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1076174257 10:128354932-128354954 CTGCATGCCAGATGCCACTCAGG - Intergenic
1076696396 10:132249369-132249391 CAGCCATGCAGATGCTGCTCAGG + Intronic
1077908864 11:6557412-6557434 CTCCCCTTCAGATTCTACTTCGG - Exonic
1079064068 11:17274613-17274635 CTGCCTCTGAGTTGCTGCTCTGG + Intronic
1079177073 11:18152324-18152346 CTGCCCCTGAGCTGCTACTCTGG - Intronic
1079607582 11:22389604-22389626 CTGCATTTCAGATGGTATTATGG - Intergenic
1081018478 11:37912485-37912507 CTGTCTCTGAGTTGCTACTCTGG - Intergenic
1081842716 11:46214944-46214966 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1083361972 11:62115439-62115461 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1083817803 11:65146759-65146781 CTACCTCTGAGCTGCTACTCGGG - Intergenic
1085518035 11:77122650-77122672 ATGCCTTTCACATTGTACTCTGG - Exonic
1085803249 11:79611250-79611272 GTGACTTTCAAATGCTCCTCAGG + Intergenic
1088181467 11:107117387-107117409 CTGCCTTTGAGCTGTTACTCTGG - Intergenic
1088263759 11:107970401-107970423 CTGCCTATGAGCTGCTTCTCTGG + Intergenic
1089552466 11:119290978-119291000 CTTCAGTTCAGATGCTACACTGG - Intronic
1089861419 11:121593369-121593391 CTGCCTTTCAGTCGCCACTCAGG + Intronic
1090713836 11:129412532-129412554 CTGCCTTTGAGCTGCTGCTCTGG - Intronic
1092064222 12:5576436-5576458 CTGGCTTTCTGGTACTACTCAGG - Intronic
1092520674 12:9269553-9269575 CTCCCTTTGAGCTGCTACTATGG + Intergenic
1093380027 12:18480786-18480808 CTGCCTCTGAGCTGCTAGTCTGG + Intronic
1093387292 12:18573549-18573571 CTTCCTTCCAGATCCTACCCTGG + Intronic
1094143834 12:27208314-27208336 CTCATTTGCAGATGCTACTCTGG + Intergenic
1095404233 12:41850187-41850209 CTTCCTTTCGCATGTTACTCTGG + Intergenic
1098898912 12:76092692-76092714 GTGCCTCTGAGCTGCTACTCTGG + Intergenic
1099307134 12:80971444-80971466 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1099869755 12:88332037-88332059 CTGCCTCTGAGGTGCTATTCTGG - Intergenic
1100645253 12:96522722-96522744 CTGCCTTACAAAAGCTGCTCAGG + Intronic
1101147075 12:101851257-101851279 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1101428760 12:104609060-104609082 CTGCCTTTTGAATGCTATTCAGG + Intronic
1101796052 12:107975285-107975307 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1102448991 12:113026485-113026507 CTGCCCTTGAGTTGCTACTCTGG - Intergenic
1102449750 12:113032574-113032596 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1102572122 12:113833247-113833269 CTGCCTTCCAGAAGCAAGTCTGG + Intronic
1103042730 12:117709275-117709297 CTCCATTTCAGAGGCTTCTCAGG + Intronic
1103746710 12:123129860-123129882 CTGCCATTCAGATGGTATGCAGG - Intronic
1103922565 12:124406616-124406638 CTGCCTTTCAGATGTGCCACTGG + Intronic
1103975037 12:124696933-124696955 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104345385 12:127991864-127991886 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104561143 12:129845866-129845888 CTGCCTCTGAGTTGCTGCTCTGG - Intronic
1104621127 12:130313601-130313623 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1106501303 13:30331496-30331518 CTGCCTTTCAGAAACCACGCAGG - Intergenic
1107049954 13:36036249-36036271 CTGCCTCTGAGCTGCTCCTCTGG + Intronic
1108754788 13:53486626-53486648 CTCCCTTTCAGATCTTACTTAGG + Intergenic
1109570622 13:64183964-64183986 ATGCCTCTGAGATGCTACTCTGG + Intergenic
1109595593 13:64549537-64549559 CTGCCTTTCAAGCGCTACTGAGG - Intergenic
1111225332 13:85263827-85263849 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1112305003 13:98265890-98265912 CTGCATGTCAGATGGTACGCTGG + Intronic
1112678026 13:101727092-101727114 CTCCCTTTCTGATTATACTCTGG - Intronic
1113219929 13:108088177-108088199 GTCCCTTTCAAATGCTACCCTGG - Intergenic
1115292957 14:31793585-31793607 GTGCCTTTCTGCAGCTACTCAGG + Intronic
1117128382 14:52657226-52657248 CTGCCTCCAAGCTGCTACTCTGG + Intronic
1117880641 14:60310060-60310082 CTGCCTTTGAACTGCTACTCTGG - Intergenic
1119931514 14:78551986-78552008 CTGGCTTTCAAATGCTGCCCAGG - Intronic
1121039596 14:90734605-90734627 CAGCCTTCAAGATGCTGCTCAGG + Intronic
1121621074 14:95348678-95348700 CATCCTTTCAGATGCGACACAGG + Intergenic
1122002695 14:98674801-98674823 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1122436459 14:101704451-101704473 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1122642202 14:103166505-103166527 CTGCTTCTCAGCTGTTACTCAGG - Intergenic
1123765823 15:23477625-23477647 CTGCCTTGCAGATGAATCTCAGG - Intergenic
1125558203 15:40603794-40603816 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1126216130 15:46157122-46157144 ATGCCATTCAGCTGCTACTAAGG - Intergenic
1126591451 15:50344107-50344129 TTGCCTGTCAGAGCCTACTCAGG - Intronic
1128330433 15:66752076-66752098 CAGCTTTTCAGTTGCTCCTCAGG + Intronic
1129003100 15:72350213-72350235 CTTTCTTTCAGATTCTACCCTGG + Intronic
1129147964 15:73666417-73666439 CGGCCTCTGAGCTGCTACTCTGG - Intergenic
1129749378 15:78049923-78049945 CTGCCTCTCAGATACAACACTGG + Intronic
1129829623 15:78660246-78660268 CTGCCTGTGAGCTGCTACTCTGG + Intronic
1129944645 15:79528156-79528178 TTGCCTTTCAGAGGCAACTGTGG + Intergenic
1132024811 15:98396190-98396212 CTGCCTTTCAAGGGCTTCTCTGG + Intergenic
1132456540 16:26820-26842 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1133165433 16:3943646-3943668 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1133447873 16:5877695-5877717 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1133506659 16:6418873-6418895 CTGACTTTCAGGTAATACTCAGG - Intronic
1134749969 16:16618123-16618145 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1134995507 16:18735492-18735514 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1135783429 16:25326464-25326486 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1135949313 16:26898428-26898450 CTGCCTTTTAGCTGTTACTCTGG + Intergenic
1137380226 16:47991525-47991547 CTTCCATTGAGATGCAACTCAGG - Intergenic
1138801081 16:60030866-60030888 CTGTCTTTGAGCTGCCACTCTGG + Intergenic
1138850810 16:60627399-60627421 CTGCCTCTGAGCTGCTACTGTGG - Intergenic
1140020849 16:71237287-71237309 CTGCCCTGGAGCTGCTACTCTGG - Intergenic
1140339809 16:74146543-74146565 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1141663982 16:85456411-85456433 CTGCCTTCCAGATTATGCTCTGG + Intergenic
1141708143 16:85680968-85680990 CTGCCTTTCAAAGGCCCCTCTGG + Intronic
1142568562 17:856893-856915 CTGCCTTTCACATTCTGTTCAGG + Intronic
1142807785 17:2380523-2380545 CTGCCTTCCACATGCTTCTCAGG + Exonic
1143437825 17:6942308-6942330 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1146480534 17:33201633-33201655 CTGCCTCTGAGCTTCTACTCTGG + Intronic
1146658306 17:34648304-34648326 CTGCCTTGGAGCTGCTACTCTGG - Intergenic
1146723202 17:35137629-35137651 CTGTCCTTCAGATTCTCCTCTGG - Exonic
1147123395 17:38349787-38349809 CTGCCTCTCAGGTGTCACTCAGG - Intergenic
1147431633 17:40374976-40374998 CTGCCTCTGAGCTGCTTCTCTGG - Intergenic
1147874083 17:43608396-43608418 CTGCCTCTGAGCTGCCACTCTGG - Intergenic
1148443637 17:47725019-47725041 CTGCCTTTCCCAGGCTACTGTGG + Intergenic
1148668671 17:49393810-49393832 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1148931114 17:51128110-51128132 CTGCCTCTGAGATGCTATTCTGG - Intergenic
1149270740 17:54974812-54974834 CTGCCTCTAAGCTGCTATTCTGG - Intronic
1150013087 17:61524652-61524674 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1155630131 18:27883375-27883397 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1156180745 18:34601195-34601217 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1156645951 18:39162503-39162525 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1157897062 18:51479205-51479227 CTGCCTTTTAGCTGCTACTCTGG - Intergenic
1158391779 18:57050560-57050582 CTGTCTTTCAGTTGCAACGCTGG + Intergenic
1158526517 18:58219583-58219605 TTGACTTGCAGATGCTCCTCTGG + Intronic
1159013720 18:63083836-63083858 CTCACTTTCAGATGGTACTGAGG + Intergenic
1159897819 18:74013283-74013305 CTGCCCCTCAGCTGCTTCTCGGG - Intergenic
1161859980 19:6790719-6790741 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1161965147 19:7543617-7543639 CTGACTTTCAGCTGGTAGTCGGG - Intronic
1161970701 19:7578278-7578300 CTGCCTCTCAGCTGCTATTCTGG - Intergenic
1162124732 19:8493385-8493407 CTGCCTCTCAGAGGCTTCCCTGG + Intronic
1164561003 19:29292212-29292234 CTGCCTCTGAACTGCTACTCTGG - Intergenic
1164779844 19:30883499-30883521 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1165200758 19:34142464-34142486 CTGCCTCTGAGCTGCTCCTCTGG - Intergenic
1167819176 19:51910388-51910410 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1168172866 19:54600802-54600824 CTGCATCTCAGAGGCTTCTCTGG - Exonic
925283671 2:2702362-2702384 CTTCCATTCAGTTACTACTCTGG + Intergenic
925362323 2:3288188-3288210 CCACCCTTCAGATGCTGCTCTGG + Intronic
926104585 2:10142315-10142337 CTGCGTGTCAGGTGTTACTCGGG + Exonic
927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG + Intergenic
927382043 2:22490254-22490276 CTGCCCTTACGCTGCTACTCTGG - Intergenic
927504222 2:23602823-23602845 TTGGCTCTCAGGTGCTACTCAGG + Intronic
927856101 2:26528905-26528927 CTGCCCTGCAGATGCCACTGGGG - Intronic
931072620 2:58670024-58670046 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
931972126 2:67600438-67600460 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
932582358 2:73000124-73000146 CTGGCTTTCAGATTCTTCTTGGG - Intronic
932811610 2:74831069-74831091 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
933592739 2:84250767-84250789 CTGCCATTCAGATGCCTCTCAGG - Intergenic
933956225 2:87375062-87375084 CTGCCATTCAGGTGCTCTTCAGG - Intergenic
934240375 2:90267086-90267108 CTGCCATTCAGGTGCTCTTCAGG - Intergenic
934890437 2:98063659-98063681 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
935828558 2:106976008-106976030 CTGCCTTTCAGGTGTGGCTCTGG - Intergenic
935876616 2:107514672-107514694 CTGCCTCTGAGCTGCTACTTTGG + Intergenic
936117094 2:109711119-109711141 CTGCCTTTCAGATGTCCCTGAGG - Intergenic
936195794 2:110371787-110371809 CTGCCATTCAGGTGCTCTTCAGG - Intergenic
936338333 2:111609619-111609641 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
937347612 2:121136258-121136280 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
940122869 2:150287071-150287093 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
942533880 2:176942328-176942350 CTCCCTTTCTGTTGCTGCTCAGG + Intergenic
942806260 2:179934529-179934551 CTGCCCTGCAGATGCTATCCTGG - Intergenic
943261175 2:185665595-185665617 CTGCCTCTGTGCTGCTACTCTGG + Intergenic
944649670 2:201816982-201817004 CTACCTATGAGCTGCTACTCTGG + Intronic
945321198 2:208425523-208425545 CTGCCTTTGAGCTGCTACTCTGG + Intronic
945369514 2:208999686-208999708 CTGCCTCTGAACTGCTACTCTGG + Intergenic
945735018 2:213588154-213588176 ATCCCTTTCACATACTACTCAGG - Intronic
946007442 2:216537809-216537831 ATGCCTTTTAGGTGCTACCCAGG + Intronic
946805877 2:223470954-223470976 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
946806661 2:223477291-223477313 CTGCCTCTGAGCTGCTATTCTGG - Intergenic
948107986 2:235430390-235430412 CTGCCTTTGAGCAGCGACTCTGG - Intergenic
948207614 2:236170588-236170610 CTGCCTCTCAGAGGGTAATCAGG - Intergenic
1169270982 20:4199248-4199270 CTGCCTCTGAGCTGCTCCTCTGG - Intergenic
1169925942 20:10783941-10783963 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1169980401 20:11378290-11378312 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1170461568 20:16581595-16581617 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1172803850 20:37597471-37597493 CTGGCTCTAAGCTGCTACTCTGG + Intergenic
1173139459 20:40469723-40469745 CTGCCTTTGGGAGGCTGCTCTGG - Intergenic
1173900026 20:46581005-46581027 CTGCCTCTGAGCTACTACTCTGG + Intronic
1174184587 20:48697714-48697736 CTGCCTCTAAGATGCTAAGCAGG + Intronic
1176518021 21:7800844-7800866 CTGCCTTCGAGCTGCTACTCTGG - Intergenic
1177082607 21:16659687-16659709 CTACCTATCAGAAGCTACTGAGG + Intergenic
1178652049 21:34430857-34430879 CTGCCTTCGAGCTGCTACTCTGG - Intergenic
1178802086 21:35805570-35805592 CTGCCTATCAGCTGCTATTTTGG + Intronic
1178974638 21:37210285-37210307 CTGCCTCTGAGCTGTTACTCTGG - Intergenic
1179413544 21:41180066-41180088 CTGCCTCTGAGCTGCTACTGTGG - Intronic
1179414426 21:41186779-41186801 CTGCCTCTGAGCTGCTACTCAGG - Intronic
1181336044 22:22129830-22129852 GAGCCTTTCAGAGGTTACTCAGG + Intergenic
1181474597 22:23160557-23160579 CTTCCAATCAGATGCTACTATGG - Intronic
1181753666 22:25007804-25007826 TTGCCTCTGAGCTGCTACTCTGG + Intronic
1181754915 22:25016951-25016973 GTGCCTCTGAGCTGCTACTCTGG - Intronic
1182029603 22:27147520-27147542 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1182111089 22:27724230-27724252 CTGTCTCTGAGCTGCTACTCTGG - Intergenic
1182120609 22:27784071-27784093 CTGCCCCTCAGAGGGTACTCGGG + Intronic
1182530479 22:30951928-30951950 TAGCCTTACAGAAGCTACTCTGG - Intronic
1185006974 22:48285054-48285076 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
949900859 3:8813801-8813823 CTGGCTTCCTGATGCTACTGGGG + Intronic
950629740 3:14274523-14274545 CTGCCTCTGAGCTGCCACTCTGG - Intergenic
951594997 3:24308948-24308970 CTGCCATACCCATGCTACTCAGG + Intronic
952715678 3:36478008-36478030 TTGCCTTTCAGACGCGAATCTGG - Intronic
955267507 3:57460912-57460934 CTATGTTTCAGATGCTGCTCTGG - Intronic
956197594 3:66668854-66668876 CTGTCTTTGAGCTGCTACTCTGG + Intergenic
956839255 3:73121774-73121796 CTGCCTCTGAGCTGCTACCCTGG - Intergenic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
957884878 3:86274033-86274055 CTGCCTTTGAGCCGCTACTCTGG + Intergenic
961503568 3:127355238-127355260 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
962320844 3:134389161-134389183 CTGGGTTTCAGATGCTCCCCAGG - Intergenic
962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG + Intergenic
962957180 3:140276868-140276890 CTGCCTTTCACAAGCTATTATGG + Intronic
963726091 3:148923179-148923201 GTGCCTCTGAGTTGCTACTCTGG - Intergenic
964510752 3:157448349-157448371 ATGCCTTTTACATGCTCCTCTGG - Intronic
965326324 3:167309141-167309163 CCACCTCTGAGATGCTACTCTGG + Intronic
966503343 3:180671360-180671382 CTGCCTCTGAGCTGCTACTCTGG + Intronic
966914830 3:184578891-184578913 CTACCTTCCAGAGGCTCCTCTGG - Intronic
967843603 3:194027222-194027244 CTGCCTCTGAGCTGATACTCAGG - Intergenic
968055602 3:195689580-195689602 CTTCCCTTCAGCTGCTGCTCAGG - Intergenic
968100188 3:195959018-195959040 CTTCCCTTCAGCTGCTGCTCAGG + Intergenic
968186550 3:196636727-196636749 CTTCCTCTCAGATGCAACCCTGG - Intergenic
968909407 4:3469873-3469895 CTGCCTGGCAGAAGCTTCTCCGG - Intronic
969356784 4:6632578-6632600 CTGCCTCTGAGTTGCTACTCTGG - Intergenic
969404965 4:6985238-6985260 CTGGGTATCAGATGCTACTATGG - Intronic
969416438 4:7062910-7062932 CTGCCTTTGAGATGTGACTAAGG + Intronic
969655787 4:8497800-8497822 CAACATTTCAGATGCCACTCAGG + Intergenic
969698964 4:8755256-8755278 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
969882103 4:10183157-10183179 GTGCCTGTGAGCTGCTACTCTGG - Intergenic
970191895 4:13525268-13525290 CTCCCTCTCTGAGGCTACTCTGG - Intergenic
970835098 4:20394618-20394640 CTACCTTTTTCATGCTACTCAGG + Intronic
971822497 4:31576281-31576303 CTGCCTTACAGTTGATATTCTGG - Intergenic
972255873 4:37354637-37354659 ATCCCCTTCACATGCTACTCTGG - Intronic
972365097 4:38367181-38367203 CTGCCTTCCAGATGCTAGGAGGG + Intergenic
972750275 4:41981335-41981357 CTGCTTTGCCGATGCTAGTCTGG - Intergenic
973725221 4:53768895-53768917 CTGCTTTGCAGATGTTGCTCAGG + Intronic
979511223 4:121556111-121556133 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
979888021 4:126056485-126056507 TTGCCTTTCAGATGATAATCTGG - Intergenic
981116362 4:140995358-140995380 CTGCCTCTGAGCTGCTACTCTGG - Intronic
983885644 4:172977312-172977334 GTGCCTCTCAAATGCTACTCAGG - Intronic
984844292 4:184097059-184097081 CTTCCTTTCAAATGCTTCTTGGG - Intronic
985503514 5:264357-264379 CTTCCCTTCAGCTGCTGCTCAGG - Intergenic
987197731 5:15544093-15544115 CTGCCTCTGAGAACCTACTCTGG + Intronic
987346788 5:16985846-16985868 CTGGCTTTCAGGAGCTACTTTGG + Intergenic
988226052 5:28412392-28412414 CTGCCTCTGAGCTGCTTCTCTGG - Intergenic
988724254 5:33909928-33909950 CTCCGTTTCAAATGCTTCTCTGG - Intergenic
989692048 5:44156272-44156294 CTGGCTTTTAGATGCTACAGAGG + Intergenic
990316014 5:54583984-54584006 CTGCCTTGCAGTGGCTCCTCAGG + Intergenic
990603691 5:57386098-57386120 CTGCCTGTCAAAAGCTTCTCAGG + Intergenic
990616007 5:57509013-57509035 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
991448466 5:66726382-66726404 CTGCCTTTGAGATTCCACTCAGG - Intronic
991944421 5:71885690-71885712 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
992113752 5:73519997-73520019 ATGCCTGTCCCATGCTACTCAGG + Intergenic
993103810 5:83575216-83575238 CTGACTTTCATATGAGACTCGGG - Intronic
993298474 5:86175528-86175550 CTGCTTTTGAGCTGCTACTCTGG + Intergenic
994146106 5:96396942-96396964 ATGCCTTTAAGATGTGACTCTGG + Intronic
994654976 5:102581295-102581317 CAGCATTTCAGTTGCTATTCAGG + Intergenic
994801292 5:104380472-104380494 CTGCCTCTGAGCTCCTACTCTGG + Intergenic
995370476 5:111412936-111412958 TTGCCTCTGAGCTGCTACTCTGG + Intronic
998685583 5:144520669-144520691 ATGCCTTTGAGCTGCCACTCTGG + Intergenic
999034598 5:148333458-148333480 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1000775130 5:165410206-165410228 CTGCCTTCGTGCTGCTACTCTGG - Intergenic
1002463933 5:179394551-179394573 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1003384358 6:5653752-5653774 TTACCTGTCAGATGCTCCTCTGG + Intronic
1003665722 6:8109541-8109563 CTTCCTTTCAGACTCTGCTCAGG + Intergenic
1003924238 6:10861924-10861946 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1005452591 6:25988194-25988216 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1007596815 6:43055996-43056018 CTGTCTTTTAGTTGCTGCTCGGG - Exonic
1008847148 6:55981416-55981438 CTACCTTTCACATCATACTCTGG + Intergenic
1009649994 6:66463380-66463402 CTGCCTCTGAAGTGCTACTCTGG + Intergenic
1012583487 6:100895971-100895993 CTGGCTTTTAGATGCTACAGAGG + Intergenic
1013509376 6:110830600-110830622 CTGCCCCTGAGCTGCTACTCTGG + Intronic
1014533189 6:122585082-122585104 CTGCCTCTGAGCTGCTATTCTGG + Intronic
1014916802 6:127160533-127160555 CTTCCTCTGAGATGGTACTCAGG - Intronic
1015940393 6:138445001-138445023 AGGCCTTTAAAATGCTACTCAGG - Intronic
1016239158 6:141908313-141908335 CTGCCTTTCAGCTGCTACTCTGG - Intergenic
1016256020 6:142106295-142106317 CTGGCTTGCAGTTGCTAGTCTGG + Intergenic
1016548061 6:145246404-145246426 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1016731610 6:147433370-147433392 CTGCCTTTCAGACCCTTCTTAGG + Intergenic
1016846711 6:148575138-148575160 CTGCCTTTCATACCCCACTCTGG - Intergenic
1017321966 6:153105011-153105033 CTTCCTTTCTGATTCTGCTCTGG - Intronic
1017716744 6:157218360-157218382 CGCCCTTTGAGATGCTTCTCAGG + Intergenic
1018536368 6:164824961-164824983 CTGCCTTCGAGCTGCTGCTCTGG + Intergenic
1019674185 7:2301522-2301544 CTGCCTCTAAGTTGCTGCTCTGG - Intronic
1020143556 7:5625467-5625489 CTTCCTTCCAGTTGCTGCTCTGG - Intronic
1020275828 7:6623865-6623887 ATGCTTCTCAGATGCTACCCAGG + Exonic
1020647086 7:10827786-10827808 CTAACTTTCAGATGCTACAGAGG + Intergenic
1021127726 7:16872619-16872641 TTGCTGTTCAGATGCTTCTCAGG - Intronic
1021650432 7:22827869-22827891 CTGCCCCTGAGCTGCTACTCTGG + Intergenic
1022687802 7:32612886-32612908 CTGCCTCTGAGCTGTTACTCTGG - Intergenic
1022716688 7:32905342-32905364 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
1024254027 7:47526615-47526637 CTGCCTGTCAGATGCTATGTGGG - Intronic
1025586694 7:62798762-62798784 CTGCCTTCCAGATTTTACCCTGG - Intergenic
1026009494 7:66625838-66625860 CTGCCTCTGAGCTGCTACGCTGG + Intergenic
1026121368 7:67540916-67540938 CTTCCTTTAAGATCATACTCAGG + Intergenic
1026222940 7:68416041-68416063 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1026236251 7:68529568-68529590 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1027250599 7:76396441-76396463 CTGCCTCTCAGCTGCTACTCTGG + Intronic
1029427652 7:100506576-100506598 CTGCCTCTCAGCTGCTATTCTGG - Intergenic
1029459073 7:100685135-100685157 ATGCCTTCCAGATGATATTCGGG - Exonic
1029570912 7:101368502-101368524 CTGCCTCTGAGCTGCTAGTCTGG - Intronic
1029576671 7:101407952-101407974 CTACCTCTGAGCTGCTACTCTGG + Intronic
1029577434 7:101412692-101412714 CTGCCTCTGAGCTGCTACTCTGG + Intronic
1030715458 7:112802757-112802779 CTGTCTTTCAGATGTTACATAGG + Intergenic
1031892330 7:127309181-127309203 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1031910647 7:127513424-127513446 CTGCCTCTGAACTGCTACTCTGG + Intergenic
1033361081 7:140639713-140639735 CTGCTGTTCAGATGCGATTCAGG - Intronic
1033527279 7:142228731-142228753 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1033920888 7:146390024-146390046 CTGCCTTTCATATTGTATTCTGG + Intronic
1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG + Intergenic
1036504046 8:9339252-9339274 CTGCCTTCCATGTGCTTCTCAGG + Intergenic
1036732346 8:11276955-11276977 ATGCCTCTGAGCTGCTACTCTGG + Intergenic
1037124853 8:15335543-15335565 CTACCTCTCAGCTGCTCCTCTGG + Intergenic
1037198763 8:16224267-16224289 TTGCCTCTGAGATGCTGCTCTGG + Intronic
1037530686 8:19769858-19769880 CTGCCTCTGGGCTGCTACTCTGG + Intergenic
1038490995 8:27971145-27971167 CTGCCTTTCAGATGCAGCCTTGG + Intronic
1039375289 8:37026714-37026736 CTGCCTCTGAGCTGCTATTCTGG + Intergenic
1040856958 8:51958383-51958405 CTGCCTCTGAGCTGTTACTCTGG - Intergenic
1041281222 8:56212078-56212100 CTGCGCTTCAGAGGCTACACAGG - Intronic
1041840671 8:62266890-62266912 CTGCCTTTGAGCTGCTCCTCTGG + Intronic
1044452749 8:92357353-92357375 CTGAGTTTTAGATGCTCCTCTGG - Intergenic
1045676643 8:104614894-104614916 CTGCCATCCAGATGCTTCTTGGG + Intronic
1045957804 8:107929412-107929434 CTGGCTTTCAGCTGCTAAACAGG - Intronic
1047526299 8:125637304-125637326 TTGCCTTTCATATGCTAATGAGG - Intergenic
1048131725 8:131705168-131705190 CTGTTTTGCAGATGCCACTCTGG - Intergenic
1048955118 8:139529576-139529598 CTGCCTTGCAGAAACAACTCAGG + Intergenic
1050895292 9:10879152-10879174 CTGGCTTTCAGATCCTTCACTGG - Intergenic
1054768817 9:69066041-69066063 CAGGCTTTCAGATGCTATGCAGG - Intronic
1055033795 9:71796678-71796700 CTGCCTCTGAGCTGCCACTCTGG + Intronic
1056283155 9:85062157-85062179 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1060874241 9:127068780-127068802 CTGCCTCTGAGCTGCTACTCTGG - Intronic
1061223142 9:129264081-129264103 CGGCCTCTGAGCTGCTACTCTGG - Intergenic
1061877221 9:133550310-133550332 CTGCCTTTCAGCTGGCACTGTGG + Intronic
1062078731 9:134607244-134607266 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1062131233 9:134894536-134894558 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1185523535 X:759802-759824 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1186045696 X:5534254-5534276 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1186604118 X:11071114-11071136 CTGCCTCCAAGCTGCTACTCTGG + Intergenic
1186731497 X:12415288-12415310 CTGCTTTTCTGATGCAACTTTGG - Intronic
1187759179 X:22561096-22561118 CTGCCATTCTTATGCTGCTCTGG - Intergenic
1188411558 X:29878294-29878316 TTGCTTTCCAGATGCAACTCAGG + Intronic
1189008357 X:37018678-37018700 CTGCCTTTCTGATGCCATTCTGG + Intergenic
1190895880 X:54617542-54617564 CTGGCTTTCAGAAACTTCTCTGG + Intergenic
1191841807 X:65518559-65518581 CTGCCTTTCAGAGGCAGGTCTGG - Intronic
1192436598 X:71147232-71147254 CTGGCTGTCACATGCTATTCTGG + Intronic
1192529731 X:71873754-71873776 CTGCCTTACAGATGGGACACTGG - Intergenic
1193514248 X:82444618-82444640 CTGACATTCAGATTTTACTCAGG + Intergenic
1194571822 X:95561837-95561859 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1195277625 X:103297778-103297800 CTGCCTTTGACCTGCTACTCTGG - Intergenic
1195277903 X:103300095-103300117 CTGCTTTTGGGCTGCTACTCTGG - Intergenic
1195313081 X:103652984-103653006 TTGCCTCTGAGCTGCTACTCTGG - Intergenic
1198759778 X:140019145-140019167 CTGCCTCTGAGCTGCTACTCTGG - Intergenic
1198762725 X:140050293-140050315 ATCCCTTTCTTATGCTACTCTGG - Intergenic
1198779007 X:140214905-140214927 CTGCCTCTGAGCTGCTACTCTGG + Intergenic
1198928522 X:141825995-141826017 CTGCCTCTGAGCTGCTATTCTGG - Intergenic
1200399822 X:156012903-156012925 CTGCCTCTGAGCTGCTACTCTGG + Intergenic