ID: 927235169

View in Genome Browser
Species Human (GRCh38)
Location 2:20866961-20866983
Sequence GGAGGGGCAAAATGCTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927235162_927235169 -1 Left 927235162 2:20866939-20866961 CCCCTAGACTAGATATTGTTTTG No data
Right 927235169 2:20866961-20866983 GGAGGGGCAAAATGCTTTAAAGG No data
927235163_927235169 -2 Left 927235163 2:20866940-20866962 CCCTAGACTAGATATTGTTTTGG No data
Right 927235169 2:20866961-20866983 GGAGGGGCAAAATGCTTTAAAGG No data
927235165_927235169 -3 Left 927235165 2:20866941-20866963 CCTAGACTAGATATTGTTTTGGA No data
Right 927235169 2:20866961-20866983 GGAGGGGCAAAATGCTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927235169 Original CRISPR GGAGGGGCAAAATGCTTTAA AGG Intergenic
No off target data available for this crispr