ID: 927236765

View in Genome Browser
Species Human (GRCh38)
Location 2:20882032-20882054
Sequence TTTGCGGAATAATTCCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927236765_927236770 8 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236770 2:20882063-20882085 CAACACAGCAGGCCTTGCTGGGG No data
927236765_927236768 6 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236768 2:20882061-20882083 TTCAACACAGCAGGCCTTGCTGG No data
927236765_927236773 19 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236773 2:20882074-20882096 GCCTTGCTGGGGGAGTGAGGTGG No data
927236765_927236776 25 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236776 2:20882080-20882102 CTGGGGGAGTGAGGTGGGTTTGG No data
927236765_927236772 16 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236772 2:20882071-20882093 CAGGCCTTGCTGGGGGAGTGAGG No data
927236765_927236771 9 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236771 2:20882064-20882086 AACACAGCAGGCCTTGCTGGGGG No data
927236765_927236775 20 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236775 2:20882075-20882097 CCTTGCTGGGGGAGTGAGGTGGG No data
927236765_927236767 -3 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236767 2:20882052-20882074 AAAGAGACTTTCAACACAGCAGG No data
927236765_927236769 7 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236769 2:20882062-20882084 TCAACACAGCAGGCCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927236765 Original CRISPR TTTGCGGAATAATTCCCTGT TGG (reversed) Intergenic