ID: 927236766

View in Genome Browser
Species Human (GRCh38)
Location 2:20882048-20882070
Sequence CTGTGTTGAAAGTCTCTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927236766_927236773 3 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236773 2:20882074-20882096 GCCTTGCTGGGGGAGTGAGGTGG No data
927236766_927236771 -7 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236771 2:20882064-20882086 AACACAGCAGGCCTTGCTGGGGG No data
927236766_927236775 4 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236775 2:20882075-20882097 CCTTGCTGGGGGAGTGAGGTGGG No data
927236766_927236776 9 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236776 2:20882080-20882102 CTGGGGGAGTGAGGTGGGTTTGG No data
927236766_927236769 -9 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236769 2:20882062-20882084 TCAACACAGCAGGCCTTGCTGGG No data
927236766_927236772 0 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236772 2:20882071-20882093 CAGGCCTTGCTGGGGGAGTGAGG No data
927236766_927236768 -10 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236768 2:20882061-20882083 TTCAACACAGCAGGCCTTGCTGG No data
927236766_927236770 -8 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236770 2:20882063-20882085 CAACACAGCAGGCCTTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927236766 Original CRISPR CTGTGTTGAAAGTCTCTTTG CGG (reversed) Intergenic