ID: 927236768

View in Genome Browser
Species Human (GRCh38)
Location 2:20882061-20882083
Sequence TTCAACACAGCAGGCCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927236766_927236768 -10 Left 927236766 2:20882048-20882070 CCGCAAAGAGACTTTCAACACAG No data
Right 927236768 2:20882061-20882083 TTCAACACAGCAGGCCTTGCTGG No data
927236765_927236768 6 Left 927236765 2:20882032-20882054 CCAACAGGGAATTATTCCGCAAA No data
Right 927236768 2:20882061-20882083 TTCAACACAGCAGGCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927236768 Original CRISPR TTCAACACAGCAGGCCTTGC TGG Intergenic