ID: 927240298

View in Genome Browser
Species Human (GRCh38)
Location 2:20915075-20915097
Sequence CCTCACCCACCCACAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927240298_927240311 27 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240311 2:20915125-20915147 CCCCCAGCTGTGGGATTGCTGGG No data
927240298_927240309 26 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240309 2:20915124-20915146 ACCCCCAGCTGTGGGATTGCTGG No data
927240298_927240306 0 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240306 2:20915098-20915120 GAGGTGAGCTAGGCTCTCTGGGG No data
927240298_927240305 -1 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240305 2:20915097-20915119 GGAGGTGAGCTAGGCTCTCTGGG No data
927240298_927240313 28 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240313 2:20915126-20915148 CCCCAGCTGTGGGATTGCTGGGG No data
927240298_927240308 18 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240308 2:20915116-20915138 TGGGGCATACCCCCAGCTGTGGG No data
927240298_927240307 17 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240307 2:20915115-20915137 CTGGGGCATACCCCCAGCTGTGG No data
927240298_927240304 -2 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240304 2:20915096-20915118 GGGAGGTGAGCTAGGCTCTCTGG No data
927240298_927240303 -10 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240303 2:20915088-20915110 GTGGGTGAGGGAGGTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927240298 Original CRISPR CCTCACCCACCCACAAGGAG AGG (reversed) Intergenic
No off target data available for this crispr