ID: 927240304

View in Genome Browser
Species Human (GRCh38)
Location 2:20915096-20915118
Sequence GGGAGGTGAGCTAGGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927240298_927240304 -2 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240304 2:20915096-20915118 GGGAGGTGAGCTAGGCTCTCTGG No data
927240302_927240304 -7 Left 927240302 2:20915080-20915102 CCTTGTGGGTGGGTGAGGGAGGT No data
Right 927240304 2:20915096-20915118 GGGAGGTGAGCTAGGCTCTCTGG No data
927240297_927240304 1 Left 927240297 2:20915072-20915094 CCACCTCTCCTTGTGGGTGGGTG No data
Right 927240304 2:20915096-20915118 GGGAGGTGAGCTAGGCTCTCTGG No data
927240291_927240304 15 Left 927240291 2:20915058-20915080 CCAGCCATGCTTGGCCACCTCTC No data
Right 927240304 2:20915096-20915118 GGGAGGTGAGCTAGGCTCTCTGG No data
927240292_927240304 11 Left 927240292 2:20915062-20915084 CCATGCTTGGCCACCTCTCCTTG No data
Right 927240304 2:20915096-20915118 GGGAGGTGAGCTAGGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927240304 Original CRISPR GGGAGGTGAGCTAGGCTCTC TGG Intergenic
No off target data available for this crispr