ID: 927240307

View in Genome Browser
Species Human (GRCh38)
Location 2:20915115-20915137
Sequence CTGGGGCATACCCCCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927240292_927240307 30 Left 927240292 2:20915062-20915084 CCATGCTTGGCCACCTCTCCTTG No data
Right 927240307 2:20915115-20915137 CTGGGGCATACCCCCAGCTGTGG No data
927240302_927240307 12 Left 927240302 2:20915080-20915102 CCTTGTGGGTGGGTGAGGGAGGT No data
Right 927240307 2:20915115-20915137 CTGGGGCATACCCCCAGCTGTGG No data
927240298_927240307 17 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240307 2:20915115-20915137 CTGGGGCATACCCCCAGCTGTGG No data
927240297_927240307 20 Left 927240297 2:20915072-20915094 CCACCTCTCCTTGTGGGTGGGTG No data
Right 927240307 2:20915115-20915137 CTGGGGCATACCCCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927240307 Original CRISPR CTGGGGCATACCCCCAGCTG TGG Intergenic
No off target data available for this crispr