ID: 927240309

View in Genome Browser
Species Human (GRCh38)
Location 2:20915124-20915146
Sequence ACCCCCAGCTGTGGGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927240302_927240309 21 Left 927240302 2:20915080-20915102 CCTTGTGGGTGGGTGAGGGAGGT No data
Right 927240309 2:20915124-20915146 ACCCCCAGCTGTGGGATTGCTGG No data
927240298_927240309 26 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240309 2:20915124-20915146 ACCCCCAGCTGTGGGATTGCTGG No data
927240297_927240309 29 Left 927240297 2:20915072-20915094 CCACCTCTCCTTGTGGGTGGGTG No data
Right 927240309 2:20915124-20915146 ACCCCCAGCTGTGGGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927240309 Original CRISPR ACCCCCAGCTGTGGGATTGC TGG Intergenic
No off target data available for this crispr