ID: 927240313

View in Genome Browser
Species Human (GRCh38)
Location 2:20915126-20915148
Sequence CCCCAGCTGTGGGATTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927240302_927240313 23 Left 927240302 2:20915080-20915102 CCTTGTGGGTGGGTGAGGGAGGT No data
Right 927240313 2:20915126-20915148 CCCCAGCTGTGGGATTGCTGGGG No data
927240298_927240313 28 Left 927240298 2:20915075-20915097 CCTCTCCTTGTGGGTGGGTGAGG No data
Right 927240313 2:20915126-20915148 CCCCAGCTGTGGGATTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927240313 Original CRISPR CCCCAGCTGTGGGATTGCTG GGG Intergenic
No off target data available for this crispr