ID: 927241231

View in Genome Browser
Species Human (GRCh38)
Location 2:20921006-20921028
Sequence CGATGGCTCACCCAGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241231_927241239 28 Left 927241231 2:20921006-20921028 CCACTAGGCTGGGTGAGCCATCG No data
Right 927241239 2:20921057-20921079 AGCACAGTAACCGACTGGCTCGG No data
927241231_927241240 29 Left 927241231 2:20921006-20921028 CCACTAGGCTGGGTGAGCCATCG No data
Right 927241240 2:20921058-20921080 GCACAGTAACCGACTGGCTCGGG No data
927241231_927241234 -9 Left 927241231 2:20921006-20921028 CCACTAGGCTGGGTGAGCCATCG No data
Right 927241234 2:20921020-20921042 GAGCCATCGAGGGAGCCTTCTGG No data
927241231_927241238 23 Left 927241231 2:20921006-20921028 CCACTAGGCTGGGTGAGCCATCG No data
Right 927241238 2:20921052-20921074 CATCTAGCACAGTAACCGACTGG No data
927241231_927241241 30 Left 927241231 2:20921006-20921028 CCACTAGGCTGGGTGAGCCATCG No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241231 Original CRISPR CGATGGCTCACCCAGCCTAG TGG (reversed) Intergenic