ID: 927241235

View in Genome Browser
Species Human (GRCh38)
Location 2:20921023-20921045
Sequence GTGCCAGAAGGCTCCCTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241235_927241239 11 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241239 2:20921057-20921079 AGCACAGTAACCGACTGGCTCGG No data
927241235_927241244 30 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241244 2:20921076-20921098 TCGGGGCACAGGCTCACACCAGG No data
927241235_927241242 19 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241242 2:20921065-20921087 AACCGACTGGCTCGGGGCACAGG No data
927241235_927241240 12 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241240 2:20921058-20921080 GCACAGTAACCGACTGGCTCGGG No data
927241235_927241238 6 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241238 2:20921052-20921074 CATCTAGCACAGTAACCGACTGG No data
927241235_927241241 13 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241235 Original CRISPR GTGCCAGAAGGCTCCCTCGA TGG (reversed) Intergenic
No off target data available for this crispr