ID: 927241236

View in Genome Browser
Species Human (GRCh38)
Location 2:20921035-20921057
Sequence TAGATGCAGAAGGTGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241236_927241244 18 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241244 2:20921076-20921098 TCGGGGCACAGGCTCACACCAGG No data
927241236_927241242 7 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241242 2:20921065-20921087 AACCGACTGGCTCGGGGCACAGG No data
927241236_927241240 0 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241240 2:20921058-20921080 GCACAGTAACCGACTGGCTCGGG No data
927241236_927241238 -6 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241238 2:20921052-20921074 CATCTAGCACAGTAACCGACTGG No data
927241236_927241239 -1 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241239 2:20921057-20921079 AGCACAGTAACCGACTGGCTCGG No data
927241236_927241241 1 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data
927241236_927241245 19 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241245 2:20921077-20921099 CGGGGCACAGGCTCACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241236 Original CRISPR TAGATGCAGAAGGTGCCAGA AGG (reversed) Intergenic