ID: 927241237

View in Genome Browser
Species Human (GRCh38)
Location 2:20921045-20921067
Sequence GTTACTGTGCTAGATGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241237_927241244 8 Left 927241237 2:20921045-20921067 CCTTCTGCATCTAGCACAGTAAC No data
Right 927241244 2:20921076-20921098 TCGGGGCACAGGCTCACACCAGG No data
927241237_927241242 -3 Left 927241237 2:20921045-20921067 CCTTCTGCATCTAGCACAGTAAC No data
Right 927241242 2:20921065-20921087 AACCGACTGGCTCGGGGCACAGG No data
927241237_927241241 -9 Left 927241237 2:20921045-20921067 CCTTCTGCATCTAGCACAGTAAC No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data
927241237_927241245 9 Left 927241237 2:20921045-20921067 CCTTCTGCATCTAGCACAGTAAC No data
Right 927241245 2:20921077-20921099 CGGGGCACAGGCTCACACCAGGG No data
927241237_927241240 -10 Left 927241237 2:20921045-20921067 CCTTCTGCATCTAGCACAGTAAC No data
Right 927241240 2:20921058-20921080 GCACAGTAACCGACTGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241237 Original CRISPR GTTACTGTGCTAGATGCAGA AGG (reversed) Intergenic