ID: 927241239

View in Genome Browser
Species Human (GRCh38)
Location 2:20921057-20921079
Sequence AGCACAGTAACCGACTGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241231_927241239 28 Left 927241231 2:20921006-20921028 CCACTAGGCTGGGTGAGCCATCG No data
Right 927241239 2:20921057-20921079 AGCACAGTAACCGACTGGCTCGG No data
927241235_927241239 11 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241239 2:20921057-20921079 AGCACAGTAACCGACTGGCTCGG No data
927241236_927241239 -1 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241239 2:20921057-20921079 AGCACAGTAACCGACTGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241239 Original CRISPR AGCACAGTAACCGACTGGCT CGG Intergenic