ID: 927241241

View in Genome Browser
Species Human (GRCh38)
Location 2:20921059-20921081
Sequence CACAGTAACCGACTGGCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241235_927241241 13 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data
927241236_927241241 1 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data
927241237_927241241 -9 Left 927241237 2:20921045-20921067 CCTTCTGCATCTAGCACAGTAAC No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data
927241231_927241241 30 Left 927241231 2:20921006-20921028 CCACTAGGCTGGGTGAGCCATCG No data
Right 927241241 2:20921059-20921081 CACAGTAACCGACTGGCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241241 Original CRISPR CACAGTAACCGACTGGCTCG GGG Intergenic