ID: 927241244

View in Genome Browser
Species Human (GRCh38)
Location 2:20921076-20921098
Sequence TCGGGGCACAGGCTCACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241235_927241244 30 Left 927241235 2:20921023-20921045 CCATCGAGGGAGCCTTCTGGCAC No data
Right 927241244 2:20921076-20921098 TCGGGGCACAGGCTCACACCAGG No data
927241237_927241244 8 Left 927241237 2:20921045-20921067 CCTTCTGCATCTAGCACAGTAAC No data
Right 927241244 2:20921076-20921098 TCGGGGCACAGGCTCACACCAGG No data
927241236_927241244 18 Left 927241236 2:20921035-20921057 CCTTCTGGCACCTTCTGCATCTA No data
Right 927241244 2:20921076-20921098 TCGGGGCACAGGCTCACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241244 Original CRISPR TCGGGGCACAGGCTCACACC AGG Intergenic