ID: 927241453

View in Genome Browser
Species Human (GRCh38)
Location 2:20923104-20923126
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241453_927241463 27 Left 927241453 2:20923104-20923126 CCTTTCCTAACCTGGATAGAATT No data
Right 927241463 2:20923154-20923176 TGGAGACTGACTGTCTTGTTGGG No data
927241453_927241462 26 Left 927241453 2:20923104-20923126 CCTTTCCTAACCTGGATAGAATT No data
Right 927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG No data
927241453_927241458 7 Left 927241453 2:20923104-20923126 CCTTTCCTAACCTGGATAGAATT No data
Right 927241458 2:20923134-20923156 AGAATGAATACCCCAGAAGATGG No data
927241453_927241464 28 Left 927241453 2:20923104-20923126 CCTTTCCTAACCTGGATAGAATT No data
Right 927241464 2:20923155-20923177 GGAGACTGACTGTCTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241453 Original CRISPR AATTCTATCCAGGTTAGGAA AGG (reversed) Intergenic
No off target data available for this crispr