ID: 927241455

View in Genome Browser
Species Human (GRCh38)
Location 2:20923109-20923131
Sequence CCCTGAATTCTATCCAGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241455_927241462 21 Left 927241455 2:20923109-20923131 CCTAACCTGGATAGAATTCAGGG No data
Right 927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG No data
927241455_927241465 30 Left 927241455 2:20923109-20923131 CCTAACCTGGATAGAATTCAGGG No data
Right 927241465 2:20923162-20923184 GACTGTCTTGTTGGGGTAAGTGG No data
927241455_927241458 2 Left 927241455 2:20923109-20923131 CCTAACCTGGATAGAATTCAGGG No data
Right 927241458 2:20923134-20923156 AGAATGAATACCCCAGAAGATGG No data
927241455_927241463 22 Left 927241455 2:20923109-20923131 CCTAACCTGGATAGAATTCAGGG No data
Right 927241463 2:20923154-20923176 TGGAGACTGACTGTCTTGTTGGG No data
927241455_927241464 23 Left 927241455 2:20923109-20923131 CCTAACCTGGATAGAATTCAGGG No data
Right 927241464 2:20923155-20923177 GGAGACTGACTGTCTTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241455 Original CRISPR CCCTGAATTCTATCCAGGTT AGG (reversed) Intergenic
No off target data available for this crispr