ID: 927241457

View in Genome Browser
Species Human (GRCh38)
Location 2:20923114-20923136
Sequence TCTTACCCTGAATTCTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241457_927241464 18 Left 927241457 2:20923114-20923136 CCTGGATAGAATTCAGGGTAAGA No data
Right 927241464 2:20923155-20923177 GGAGACTGACTGTCTTGTTGGGG No data
927241457_927241458 -3 Left 927241457 2:20923114-20923136 CCTGGATAGAATTCAGGGTAAGA No data
Right 927241458 2:20923134-20923156 AGAATGAATACCCCAGAAGATGG No data
927241457_927241462 16 Left 927241457 2:20923114-20923136 CCTGGATAGAATTCAGGGTAAGA No data
Right 927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG No data
927241457_927241465 25 Left 927241457 2:20923114-20923136 CCTGGATAGAATTCAGGGTAAGA No data
Right 927241465 2:20923162-20923184 GACTGTCTTGTTGGGGTAAGTGG No data
927241457_927241463 17 Left 927241457 2:20923114-20923136 CCTGGATAGAATTCAGGGTAAGA No data
Right 927241463 2:20923154-20923176 TGGAGACTGACTGTCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241457 Original CRISPR TCTTACCCTGAATTCTATCC AGG (reversed) Intergenic
No off target data available for this crispr