ID: 927241462

View in Genome Browser
Species Human (GRCh38)
Location 2:20923153-20923175
Sequence ATGGAGACTGACTGTCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241455_927241462 21 Left 927241455 2:20923109-20923131 CCTAACCTGGATAGAATTCAGGG No data
Right 927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG No data
927241453_927241462 26 Left 927241453 2:20923104-20923126 CCTTTCCTAACCTGGATAGAATT No data
Right 927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG No data
927241457_927241462 16 Left 927241457 2:20923114-20923136 CCTGGATAGAATTCAGGGTAAGA No data
Right 927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241462 Original CRISPR ATGGAGACTGACTGTCTTGT TGG Intergenic
No off target data available for this crispr