ID: 927241502

View in Genome Browser
Species Human (GRCh38)
Location 2:20923379-20923401
Sequence CAGGTGGGACATTTTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927241493_927241502 19 Left 927241493 2:20923337-20923359 CCTATTTTACCCTAGGAGAAAGA No data
Right 927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG No data
927241495_927241502 9 Left 927241495 2:20923347-20923369 CCTAGGAGAAAGAAAGTAAAGAT No data
Right 927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG No data
927241494_927241502 10 Left 927241494 2:20923346-20923368 CCCTAGGAGAAAGAAAGTAAAGA No data
Right 927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927241502 Original CRISPR CAGGTGGGACATTTTGAGGT GGG Intergenic
No off target data available for this crispr