ID: 927244014 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:20942444-20942466 |
| Sequence | GTTTAAGTGATCAGTGATCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927244014_927244018 | 28 | Left | 927244014 | 2:20942444-20942466 | CCTGGATCACTGATCACTTAAAC | No data | ||
| Right | 927244018 | 2:20942495-20942517 | AAGTCACAAGTCATGCCCCCTGG | No data | ||||
| 927244014_927244016 | -6 | Left | 927244014 | 2:20942444-20942466 | CCTGGATCACTGATCACTTAAAC | No data | ||
| Right | 927244016 | 2:20942461-20942483 | TTAAACAGCTCTTTGGCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927244014 | Original CRISPR | GTTTAAGTGATCAGTGATCC AGG (reversed) | Intergenic | ||