ID: 927244014

View in Genome Browser
Species Human (GRCh38)
Location 2:20942444-20942466
Sequence GTTTAAGTGATCAGTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927244014_927244018 28 Left 927244014 2:20942444-20942466 CCTGGATCACTGATCACTTAAAC No data
Right 927244018 2:20942495-20942517 AAGTCACAAGTCATGCCCCCTGG No data
927244014_927244016 -6 Left 927244014 2:20942444-20942466 CCTGGATCACTGATCACTTAAAC No data
Right 927244016 2:20942461-20942483 TTAAACAGCTCTTTGGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927244014 Original CRISPR GTTTAAGTGATCAGTGATCC AGG (reversed) Intergenic