ID: 927249539

View in Genome Browser
Species Human (GRCh38)
Location 2:20985248-20985270
Sequence TCTGCTATGCACAGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927249538_927249539 19 Left 927249538 2:20985206-20985228 CCTTTGAAAGAGGGTTGAGAACA No data
Right 927249539 2:20985248-20985270 TCTGCTATGCACAGAGTAGAAGG No data
927249537_927249539 20 Left 927249537 2:20985205-20985227 CCCTTTGAAAGAGGGTTGAGAAC No data
Right 927249539 2:20985248-20985270 TCTGCTATGCACAGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927249539 Original CRISPR TCTGCTATGCACAGAGTAGA AGG Intergenic
No off target data available for this crispr