ID: 927250460

View in Genome Browser
Species Human (GRCh38)
Location 2:20991363-20991385
Sequence CTGTGAGTCTCCCAGTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927250460_927250466 29 Left 927250460 2:20991363-20991385 CCACCAGACTGGGAGACTCACAG No data
Right 927250466 2:20991415-20991437 ATTTCCCAAGACTCTGTGCTGGG No data
927250460_927250465 28 Left 927250460 2:20991363-20991385 CCACCAGACTGGGAGACTCACAG No data
Right 927250465 2:20991414-20991436 AATTTCCCAAGACTCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927250460 Original CRISPR CTGTGAGTCTCCCAGTCTGG TGG (reversed) Intergenic
No off target data available for this crispr