ID: 927250755

View in Genome Browser
Species Human (GRCh38)
Location 2:20993127-20993149
Sequence CTCCCTTTCCCCTCCTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927250755_927250756 -3 Left 927250755 2:20993127-20993149 CCTACATAGGAGGGGAAAGGGAG No data
Right 927250756 2:20993147-20993169 GAGTAAGCCACACCTGAGAGTGG No data
927250755_927250761 26 Left 927250755 2:20993127-20993149 CCTACATAGGAGGGGAAAGGGAG No data
Right 927250761 2:20993176-20993198 GAGCATGGAGTGATGCGAAGTGG No data
927250755_927250762 30 Left 927250755 2:20993127-20993149 CCTACATAGGAGGGGAAAGGGAG No data
Right 927250762 2:20993180-20993202 ATGGAGTGATGCGAAGTGGCAGG No data
927250755_927250757 -2 Left 927250755 2:20993127-20993149 CCTACATAGGAGGGGAAAGGGAG No data
Right 927250757 2:20993148-20993170 AGTAAGCCACACCTGAGAGTGGG No data
927250755_927250760 11 Left 927250755 2:20993127-20993149 CCTACATAGGAGGGGAAAGGGAG No data
Right 927250760 2:20993161-20993183 TGAGAGTGGGCAGCAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927250755 Original CRISPR CTCCCTTTCCCCTCCTATGT AGG (reversed) Intergenic
No off target data available for this crispr