ID: 927251704

View in Genome Browser
Species Human (GRCh38)
Location 2:21000486-21000508
Sequence TTCACTCAGCCTGCCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927251704_927251708 13 Left 927251704 2:21000486-21000508 CCACTCCTGGCAGGCTGAGTGAA 0: 1
1: 0
2: 2
3: 21
4: 179
Right 927251708 2:21000522-21000544 TATTTCATCTCGAGGCCTACCGG 0: 1
1: 0
2: 0
3: 3
4: 44
927251704_927251707 5 Left 927251704 2:21000486-21000508 CCACTCCTGGCAGGCTGAGTGAA 0: 1
1: 0
2: 2
3: 21
4: 179
Right 927251707 2:21000514-21000536 GGACTTGTTATTTCATCTCGAGG 0: 1
1: 0
2: 0
3: 22
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927251704 Original CRISPR TTCACTCAGCCTGCCAGGAG TGG (reversed) Intergenic
900345471 1:2208373-2208395 TGCAATCCGCTTGCCAGGAGGGG - Intronic
900796069 1:4709195-4709217 TTGATTCAGCCTGCCTGGTGGGG + Intronic
902076342 1:13789928-13789950 TTCACTGAGGCTGCCTGAAGCGG - Intronic
902154621 1:14474755-14474777 TTCAGTCATCCAGCCAAGAGTGG + Intergenic
903485097 1:23684012-23684034 TTCAGCCAGACTCCCAGGAGGGG - Intergenic
903809190 1:26025274-26025296 TTCACTCAGCCGGGCGAGAGTGG + Intronic
903929328 1:26853372-26853394 GTCACCCAGCCTGCCTAGAGGGG + Intronic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
907330428 1:53667433-53667455 GTCACTCAGCCAGGGAGGAGTGG + Intronic
911180292 1:94854555-94854577 TTCACACAGCCATCCAGGAGAGG + Intronic
911195995 1:94996337-94996359 TTCAGTCAACCTGGCAGAAGGGG + Intronic
915724086 1:158005456-158005478 TTCACTCAGGCTGCCAGCTGTGG + Intronic
920309131 1:205038313-205038335 TTTACTAAGCCTGCCCGGGGTGG - Intergenic
921673664 1:217953474-217953496 TTCACTCAGTCTGCCCTAAGGGG - Intergenic
922573106 1:226645296-226645318 TTCCCTCTGCCTGCCAAGATGGG + Intronic
922617908 1:226974007-226974029 TTCACCCAGCCTGCTAGGAAGGG + Intronic
923041938 1:230325788-230325810 CTCACCCAGCCTGGCAGAAGGGG - Intronic
924097225 1:240564930-240564952 GTAACTCAGCCTTCCAGGACTGG + Intronic
1063874306 10:10456452-10456474 TTCACTCAGGCAGCCGGGCGTGG - Intergenic
1064988997 10:21239485-21239507 TTCAGTGAGCCTGACAGGACTGG - Intergenic
1067674653 10:48361879-48361901 TTCAGTCTGCATGCCAGGAAGGG - Intronic
1069875812 10:71562240-71562262 TTCACACAGTCAGCCAGGACAGG - Intronic
1071505551 10:86229471-86229493 CTCACTCAGCCTGTGAGGCGGGG - Intronic
1072103863 10:92255264-92255286 TTCAAATAGCCTGCCAGGAATGG - Intronic
1073570363 10:104576196-104576218 TTCCCACAGCCTTCCAGGCGGGG + Intergenic
1076652048 10:131996680-131996702 TGCACCCAAGCTGCCAGGAGTGG + Intergenic
1076758676 10:132589213-132589235 TTCACTCTGCCTGCCTGCTGAGG + Intronic
1077369120 11:2173345-2173367 AGCACTCAGCCTGCCTGCAGAGG - Intergenic
1079388842 11:20003523-20003545 ATGACTCAGCGTGCCAGGTGTGG + Intronic
1079660982 11:23035970-23035992 GTCACTCATCCTGCAAGGGGTGG + Intergenic
1081700446 11:45149183-45149205 ATCACTCTGACTGCCATGAGGGG - Intronic
1081749953 11:45502621-45502643 GTCACTCGGCCAGCCAGGAAAGG - Intergenic
1083758143 11:64802295-64802317 GTCACACAGCCAGGCAGGAGTGG + Intronic
1084789794 11:71466586-71466608 TTCACTCTCTCTGCCAGCAGAGG + Intronic
1088157752 11:106829415-106829437 GTCACTCAGCCAGCAAGTAGTGG - Intronic
1088648175 11:111934441-111934463 TTCACTCTGCCTGGAAGCAGAGG - Intronic
1095962597 12:47844799-47844821 TGCACTCAGGCTGGAAGGAGAGG + Exonic
1096097642 12:48946981-48947003 TGCACTCTGCCTGGCAGCAGAGG - Intronic
1096547818 12:52353108-52353130 TTCACACAGCCTGCAGGGAGAGG - Intergenic
1097288442 12:57895144-57895166 TCCACTCTGCCTCCCAGGACAGG - Intergenic
1101827952 12:108235402-108235424 TTCCATCAGACTGTCAGGAGCGG + Intronic
1101838034 12:108308678-108308700 TTGAGTCAGCCTGTCTGGAGGGG - Intronic
1102721822 12:115023110-115023132 TTCACTCAGCCACGCAGGATAGG + Intergenic
1104783453 12:131434921-131434943 TCCACTCAGCCTGGGAGGGGTGG - Intergenic
1104883098 12:132085396-132085418 GCCAATCAGCCTGCCTGGAGCGG - Intronic
1110973108 13:81792161-81792183 TCCCCTCACCCTGCCAGAAGTGG - Intergenic
1112972316 13:105275056-105275078 TGCACACAGCCTGCAAGAAGAGG + Intergenic
1113022628 13:105905314-105905336 TTCATTCACCCTACCAGGACCGG + Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1117338146 14:54772370-54772392 TTCACTCTGGTTGCCAGCAGTGG + Intronic
1123035796 14:105471415-105471437 CTACCTCAGCCGGCCAGGAGGGG + Intergenic
1125361902 15:38873233-38873255 TTCTCTTAGGCTGCCAGTAGTGG - Intergenic
1127682793 15:61313975-61313997 GTCACTCAGCTTGTAAGGAGTGG + Intergenic
1128109314 15:65066915-65066937 CTCCTTCAGCCAGCCAGGAGTGG + Intronic
1128237189 15:66076472-66076494 TTTACCCAGCCTGCCAGAATGGG + Intronic
1128617555 15:69121986-69122008 TTCCCTCAGTCTGCGAGGACTGG + Intergenic
1128682850 15:69664163-69664185 TACACTCTTCCTGCCAGGAATGG + Intergenic
1129325442 15:74798076-74798098 TACCGTCAGCCTGCCAGGACTGG + Intronic
1129538644 15:76334026-76334048 TTCAGACAGCTGGCCAGGAGGGG - Intergenic
1129659222 15:77543626-77543648 GTCACTCAGCAAGCCAGGCGCGG + Intergenic
1132519287 16:379971-379993 TTCACTCAGGTTCCCAGGACAGG - Intronic
1133980594 16:10630486-10630508 CTCCCTCCGCCTCCCAGGAGAGG + Intronic
1137729240 16:50677621-50677643 TTCCCTCTGCCTGCCAGGAGGGG - Intronic
1142278174 16:89133798-89133820 TTCTCTCTGCCTGCCAGAACAGG + Intronic
1142361604 16:89630292-89630314 GCCACTCTGCCTGCCAGGAGAGG - Exonic
1142814287 17:2412987-2413009 TTCACACACCCTGCCCGGGGAGG + Intronic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1144826533 17:18108517-18108539 TTCTGTGAGGCTGCCAGGAGGGG + Intergenic
1145000094 17:19298538-19298560 ATCACTCAGGCTGGCTGGAGCGG + Intronic
1146211741 17:30948593-30948615 ATCACTCAGGCTGCCATGAGAGG + Intronic
1148713735 17:49700554-49700576 TTAACCCAGCCTCCCTGGAGGGG + Intergenic
1149513598 17:57262865-57262887 TTCACTGAGCTTGCCAGGTGTGG + Intronic
1151479431 17:74361651-74361673 TGCACGCGGCCGGCCAGGAGGGG - Intronic
1151707684 17:75779352-75779374 ATGACTCAGGCTGCGAGGAGCGG + Intronic
1152412344 17:80133889-80133911 CTCACTCAGCAAGCCAGGACAGG + Intergenic
1152573492 17:81130507-81130529 TTCACTCAGGCTGCGAGGAGGGG - Intronic
1155997308 18:32343833-32343855 TTCTCCCAGGCTGCCAGGAGCGG - Intronic
1157528965 18:48406183-48406205 TTCCCACAGCCTGCTATGAGAGG + Intronic
1158182400 18:54731428-54731450 TTCACCCAATCTGCCAGGTGTGG + Intronic
1159583651 18:70262369-70262391 TTCATTCAGGGTGACAGGAGGGG - Intergenic
1162991271 19:14303940-14303962 GTCACCCAGCCAGCCAGGGGAGG + Intergenic
1163414320 19:17176732-17176754 TTCCCCCATCCTGCCTGGAGTGG + Intronic
1165096818 19:33414062-33414084 ACCACCCACCCTGCCAGGAGGGG + Intronic
1166947533 19:46406137-46406159 GTCACACAGCTTGCAAGGAGCGG + Intergenic
1167371740 19:49086567-49086589 TTCACTGAGCAGGCCAGGAATGG + Intronic
1168008219 19:53508253-53508275 TGCACTCATTCTGCCAGGAATGG - Intergenic
926754730 2:16225731-16225753 CTCACCCTGCCTGCCAGAAGAGG + Intergenic
927251704 2:21000486-21000508 TTCACTCAGCCTGCCAGGAGTGG - Intergenic
929599093 2:43194031-43194053 GTCACACAGCCTGGAAGGAGTGG + Intergenic
930758520 2:55004913-55004935 TTCACTAAGCCTCCCTGGGGAGG - Intronic
935290806 2:101609558-101609580 CTCACTGAGCCTCCCTGGAGAGG + Intergenic
935384464 2:102486184-102486206 GTCACTCAGCTTGCAAGGAGTGG - Intronic
935810387 2:106791634-106791656 TTCACTATACCTGCAAGGAGAGG - Intergenic
937025346 2:118692960-118692982 TCCCCTCAGCCTGCAGGGAGAGG + Intergenic
937094579 2:119227067-119227089 AACACTCATCCTGCCAGAAGTGG - Intronic
937106821 2:119323564-119323586 ATCACCCAGCCTGGCACGAGTGG + Intronic
937316799 2:120936853-120936875 TTGACTCGGGCTGGCAGGAGTGG - Intronic
939721059 2:145652093-145652115 TTCACCAAGCCTGCCATGATAGG + Intergenic
944206815 2:197165163-197165185 TTCAGCCAGCCAGCCAGAAGGGG - Intronic
947736307 2:232457255-232457277 CTGCCTCAGCCCGCCAGGAGGGG + Exonic
948690743 2:239702433-239702455 TTCACACCCCCTGCCAAGAGAGG + Intergenic
948871142 2:240798835-240798857 TTCATGCAGCCTGACACGAGAGG + Intronic
1168761707 20:354099-354121 TTCACTCATCCTGCAGGGAAAGG - Exonic
1170812268 20:19683880-19683902 TTCATCCAGCCAGCCAGGAAGGG - Intronic
1172683575 20:36736414-36736436 TTCACACAGCCAGCTAGGTGTGG + Intronic
1172697197 20:36831087-36831109 TTCCCTCAACCAGCCAGCAGGGG - Intronic
1175726697 20:61323330-61323352 GTTCATCAGCCTGCCAGGAGGGG + Intronic
1178022911 21:28430362-28430384 ATCACTCTGCCTGCCTGGGGCGG - Intergenic
1179628280 21:42660764-42660786 TGCACTCAGCCACCCAGGGGTGG + Intronic
1179808755 21:43856723-43856745 TTCACTGAGCCGGCCAGGTGCGG - Intergenic
1179950898 21:44708345-44708367 GGCACACAGCCTTCCAGGAGCGG + Intronic
1182394729 22:30026919-30026941 CCCACTCAGACAGCCAGGAGTGG - Exonic
1185089018 22:48755620-48755642 GGCACGCAGCCTCCCAGGAGCGG - Intronic
1185263505 22:49884825-49884847 CTCAGTCAGCCTGTCAGGGGAGG - Exonic
1185288315 22:50012065-50012087 CTCACTCAGCCTTACAGGAGAGG - Intronic
950042467 3:9929022-9929044 TTCACTCATCCGGCCAGGCGCGG + Intronic
950709514 3:14804527-14804549 CACACCCAGCCAGCCAGGAGGGG + Intergenic
952937585 3:38412343-38412365 TTCACACAGCTGTCCAGGAGAGG - Intronic
953794594 3:45974825-45974847 TTCACTCAGTATGCCAGGTGAGG + Intronic
955115924 3:56001690-56001712 TTCACTCTCCCTGTCAGGATAGG - Intronic
956622996 3:71239861-71239883 CTCACTCAGCCTGGTAGCAGTGG - Intronic
956800563 3:72754251-72754273 TTCACTCAGCCAACAAGGGGCGG + Intronic
960845988 3:122005169-122005191 CTGACTCAGCCTGCCAGGCCTGG + Intronic
961035746 3:123640491-123640513 TTCCCGCAGCGTGTCAGGAGGGG - Exonic
961622643 3:128236782-128236804 TTAAATCAGGCTGTCAGGAGAGG - Intronic
961809553 3:129514006-129514028 TGCTCTCACCCTGCCAGGTGGGG - Intronic
963007138 3:140737036-140737058 TTCTCTCAGCCAGCCAAGAAGGG - Intergenic
964983196 3:162710898-162710920 CTCACTCAGCTTGCAGGGAGGGG - Intergenic
965338617 3:167458550-167458572 TTCACTAAGACAGCCGGGAGCGG - Intronic
966535891 3:181033301-181033323 GTCACTCAACCAGGCAGGAGTGG - Intergenic
967989961 3:195123351-195123373 TTCCGTCAGCCGGCCAGGAGAGG - Intronic
970272381 4:14360770-14360792 TTCACACAGTGTGCCGGGAGGGG + Intergenic
971211582 4:24622932-24622954 TTCATTCAACATGCCAGGATAGG - Intergenic
971301303 4:25444434-25444456 TTAACTCAGACTCCAAGGAGGGG + Intergenic
975229980 4:71922047-71922069 TTGACTCAGCGTGGCTGGAGAGG + Intergenic
975376565 4:73652753-73652775 TCCACTCATGCTTCCAGGAGAGG + Intergenic
984240718 4:177216328-177216350 CTCACTCAGTCACCCAGGAGTGG + Intergenic
984649570 4:182255691-182255713 GTCACACAGCCTGCCAGAATTGG + Intronic
986766499 5:10932766-10932788 TTCATTCAGCCTGCACTGAGTGG + Intergenic
994251568 5:97542266-97542288 CTCCCTCAGCCTGCGGGGAGGGG - Intergenic
995050949 5:107702727-107702749 GTCACACAGCTAGCCAGGAGAGG - Intergenic
995614731 5:113949061-113949083 TTCACTCTGGCTGATAGGAGCGG + Intergenic
995826564 5:116306106-116306128 TTCACTCCGCCTCCCAGTTGGGG - Intronic
997359908 5:133288430-133288452 TTCAGTGAGCGGGCCAGGAGTGG - Intronic
997453397 5:134001228-134001250 GTAACACAGCCTGGCAGGAGTGG - Intronic
997738566 5:136233569-136233591 TTCACTGATCCTGCCAGGAAGGG - Intronic
998226925 5:140334384-140334406 TTCACTCTGTCTCCCAGGGGAGG + Intronic
998849370 5:146338936-146338958 TACAAGCAGCCTGCCAGGAAGGG - Intronic
1002278205 5:178116386-178116408 TCCAGTCAGTCAGCCAGGAGGGG + Intronic
1005678330 6:28179663-28179685 TTCACTGAGACTGACAGGTGTGG - Intergenic
1006916749 6:37599676-37599698 TTGGCTCAGACTCCCAGGAGTGG - Intergenic
1007301863 6:40873803-40873825 TGCACTCATCCAGCCCGGAGGGG - Intergenic
1011494627 6:87925956-87925978 GTCACTCAGCTGGCCAGGAGTGG + Intergenic
1011811065 6:91132926-91132948 TTCACTCAGGCTTCCAGATGGGG + Intergenic
1013230273 6:108156457-108156479 CTCACTGAGCCTGCCCAGAGGGG + Intronic
1016002861 6:139059999-139060021 TTCACACAGCATGCTTGGAGAGG - Intergenic
1017700466 6:157064689-157064711 TCCACTCAGCTGGTCAGGAGAGG - Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019100926 6:169628627-169628649 TTCTCTCATCCTCCCAGGACAGG + Intronic
1019806723 7:3131992-3132014 TTCTCTCAGCTTCCTAGGAGTGG + Intergenic
1019996133 7:4725566-4725588 TTCACGCAGACTGGCCGGAGGGG - Intronic
1022513783 7:30962630-30962652 AGCTCTCAGCCTGCCAAGAGAGG + Intronic
1023801532 7:43839099-43839121 TTCAACCAGACAGCCAGGAGGGG - Intergenic
1024467312 7:49725272-49725294 TTCACTCAGCCTGTCACCATGGG + Intergenic
1025016304 7:55441443-55441465 TTCACTCACCATGGCAAGAGTGG + Intronic
1026776582 7:73234811-73234833 GGCTCTCAGCCTGGCAGGAGAGG + Intergenic
1027017433 7:74788181-74788203 GGCTCTCAGCCTGGCAGGAGAGG + Intronic
1027024898 7:74844155-74844177 TTCGCTGGGCATGCCAGGAGTGG - Intronic
1027062866 7:75099964-75099986 TTCGCTGGGCATGCCAGGAGTGG + Intronic
1027070589 7:75157751-75157773 GGCTCTCAGCCTGGCAGGAGAGG - Intergenic
1027139995 7:75650154-75650176 CTCCCGCAGCCTGCCTGGAGAGG - Intronic
1028097851 7:86784576-86784598 TTCACTCAGCCTGACTGAAATGG - Intronic
1031894051 7:127327631-127327653 TTCTCCCAGCCTGCCTGGGGTGG - Intergenic
1033137365 7:138796525-138796547 TGCACACAGCCTGCCATGTGTGG - Intronic
1034309716 7:150076598-150076620 TCCACTCAATCTGCCAGGAGAGG - Intergenic
1034797138 7:154024044-154024066 TCCACTCAATCTGCCAGGAGAGG + Intronic
1035035063 7:155889497-155889519 CTCACTCATGCAGCCAGGAGAGG + Intergenic
1035068277 7:156123388-156123410 CTCCCTCCGCCTCCCAGGAGTGG + Intergenic
1041738135 8:61132838-61132860 TGCACGCAGCCTGCCATTAGTGG + Intronic
1041792722 8:61714655-61714677 GTCACTCAGCCTTCCGGGGGCGG - Intergenic
1044802576 8:95972368-95972390 TCCAAGCTGCCTGCCAGGAGAGG - Intergenic
1045278531 8:100728408-100728430 TTGCCTCAGCCTCCCAGTAGTGG - Intergenic
1045728163 8:105200461-105200483 CTCACTGGGCCTGTCAGGAGAGG - Intronic
1047990060 8:130276871-130276893 TGCACTCACAGTGCCAGGAGCGG + Intronic
1051003946 9:12319152-12319174 TTCACTCTGCTTGCTAGAAGAGG - Intergenic
1053566786 9:39260991-39261013 AGCACACAGCCTTCCAGGAGTGG - Intronic
1053832567 9:42098837-42098859 AGCACACAGCCTTCCAGGAGTGG - Intronic
1054130357 9:61358016-61358038 AGCACACAGCCTTCCAGGAGTGG + Intergenic
1054597986 9:67088575-67088597 AGCACACAGCCTTCCAGGAGTGG + Intergenic
1056811835 9:89771133-89771155 TTCTCACAGCCACCCAGGAGAGG - Intergenic
1059840867 9:118214227-118214249 TCCTCTCAGCCTGTCAGGAAAGG - Intergenic
1060725177 9:126001567-126001589 TTCACACAGTCTGCCAGGCAGGG - Intergenic
1060740816 9:126096592-126096614 ATAACTCAGCCTGCCAGCGGAGG - Intergenic
1061608397 9:131729303-131729325 GTCAAGCAGCCTGCCAGGGGAGG - Intronic
1062681645 9:137785193-137785215 TTCACTAGGCCTCCCAGGAGAGG - Intronic
1185797018 X:2973836-2973858 TTCACTCAGCCTGCCATTCCTGG + Intergenic
1187082133 X:16002037-16002059 TCCACTCAGCCTGCTAGGAATGG + Intergenic
1189897786 X:45673510-45673532 TTCACTCACGCTGGCAGCAGTGG - Intergenic
1190265792 X:48826658-48826680 CTCACTCGGCCGGCCGGGAGGGG + Intergenic
1196053097 X:111326240-111326262 TTCTCTCAGCCTACCAGGGTGGG + Intronic
1196691032 X:118558261-118558283 TTCACACAGGCGGCCAGGAGCGG - Intronic
1200123593 X:153802770-153802792 TTCAGGCAGCCTGGCAGAAGTGG - Exonic
1200901293 Y:8434742-8434764 TTGTCTCACCCTGACAGGAGGGG - Intergenic