ID: 927252469

View in Genome Browser
Species Human (GRCh38)
Location 2:21009241-21009263
Sequence AAACCTGGCCTACCAGAGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 330}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927252467_927252469 9 Left 927252467 2:21009209-21009231 CCAATCAGAAATGTAGGTGACAA 0: 1
1: 0
2: 2
3: 24
4: 177
Right 927252469 2:21009241-21009263 AAACCTGGCCTACCAGAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 330
927252466_927252469 12 Left 927252466 2:21009206-21009228 CCACCAATCAGAAATGTAGGTGA 0: 1
1: 0
2: 2
3: 12
4: 138
Right 927252469 2:21009241-21009263 AAACCTGGCCTACCAGAGACAGG 0: 1
1: 0
2: 0
3: 17
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927252469 Original CRISPR AAACCTGGCCTACCAGAGAC AGG Exonic
902140219 1:14347373-14347395 AATCCTGCCCTACCAGAAAATGG + Intergenic
903797000 1:25936838-25936860 AAACCACTGCTACCAGAGACAGG - Intergenic
903862870 1:26375579-26375601 AAACCTGGCATACCAGCAAAAGG - Intergenic
904484712 1:30817100-30817122 AAACCAGGCCTGGCAGGGACTGG - Intergenic
905632224 1:39525184-39525206 AGGCCTGGCCTCCCAGAGCCTGG + Intronic
905665516 1:39761004-39761026 AGGCCTGGCCTCCCAGAGACTGG - Intronic
906937892 1:50230309-50230331 ACACCAGGCCTACTACAGACTGG + Intergenic
910763531 1:90758488-90758510 AACCCTGACCTACAACAGACAGG - Intergenic
913125246 1:115781069-115781091 AAAGCTGGGCTGCCAGAGAGGGG + Intergenic
913722937 1:121618732-121618754 AAACCTGAACTATCAGAGAAAGG + Intergenic
913722952 1:121619000-121619022 AAACCTGAACTATCAGAGAAAGG + Intergenic
913722979 1:121619536-121619558 AAACCTGAACTATCAGAGAAAGG + Intergenic
913723126 1:121621401-121621423 AAACCTGAACTATCAGAGAAAGG + Intergenic
913723140 1:121621669-121621691 AAACCTGAACTATCAGAGAAAGG + Intergenic
913723461 1:121625672-121625694 AAACCTGAACTATCAGAGAAAGG + Intergenic
913728916 1:121687935-121687957 AAACCTGAACTATCAGAGAAAGG + Intergenic
913732583 1:121732709-121732731 AAACCTGAACTATCAGAGAAAGG + Intergenic
913732957 1:121736742-121736764 AAACCTGAACTATCAGAGAAAGG + Intergenic
913733104 1:121738606-121738628 AAACCTGAACTATCAGAGAAAGG + Intergenic
913733304 1:121741318-121741340 AAACCTGAACTATCAGAGAAAGG + Intergenic
913737783 1:121805215-121805237 AAACCTGGACTGTCAGAGAAAGG + Intergenic
913739459 1:121824702-121824724 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739473 1:121824970-121824992 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739628 1:121826952-121826974 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739642 1:121827220-121827242 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739657 1:121827488-121827510 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739671 1:121827756-121827778 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739857 1:121829992-121830014 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739871 1:121830260-121830282 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739885 1:121830528-121830550 AAACCTGAACTATCAGAGAAAGG + Intergenic
913739899 1:121830796-121830818 AAACCTGAACTATCAGAGAAAGG + Intergenic
913740048 1:121832661-121832683 AAACCTGAACTATCAGAGAAAGG + Intergenic
913740062 1:121832929-121832951 AAACCTGAACTATCAGAGAAAGG + Intergenic
913740370 1:121836659-121836681 AAACCTGAACTATCAGAGAAAGG + Intergenic
913740383 1:121836927-121836949 AAACCTGAACTATCAGAGAAAGG + Intergenic
913742698 1:121865988-121866010 AAACCTGAACTATCAGAGAAAGG + Intergenic
913742712 1:121866256-121866278 AAACCTGAACTATCAGAGAAAGG + Intergenic
913742840 1:121867856-121867878 AAACCTGAACTATCAGAGAAAGG + Intergenic
913742854 1:121868124-121868146 AAACCTGAACTATCAGAGAAAGG + Intergenic
913742869 1:121868392-121868414 AAACCTGAACTATCAGAGAAAGG + Intergenic
913742883 1:121868660-121868682 AAACCTGAACTATCAGAGAAAGG + Intergenic
913744389 1:121885663-121885685 AAACCTGAACTATCAGAGAAAGG + Intergenic
913748485 1:121934363-121934385 AAACCTGAACTATCAGAGAAAGG + Intergenic
913748573 1:121935435-121935457 AAACCTGAACTATCAGAGAAAGG + Intergenic
913748875 1:121939165-121939187 AAACCTGAACTATCAGAGAAAGG + Intergenic
913750292 1:121956697-121956719 AAACCTGAACTATCAGAGAAAGG + Intergenic
913750306 1:121956965-121956987 AAACCTGAACTATCAGAGAAAGG + Intergenic
913750321 1:121957233-121957255 AAACCTGAACTATCAGAGAAAGG + Intergenic
913750335 1:121957501-121957523 AAACCTGAACTATCAGAGAAAGG + Intergenic
913752454 1:122033976-122033998 AAACCTGAACTATCAGAGAAAGG - Intergenic
913753598 1:122047042-122047064 AAACCTGAACTATCAGAGAAAGG - Intergenic
913753609 1:122047212-122047234 AAACCTGAACTATCAGAGAAAGG - Intergenic
913753617 1:122047382-122047404 AAACCTGAACTATCAGAGAAAGG - Intergenic
913754885 1:122062397-122062419 AAACCTGAACTATCAGAGAAAGG - Intergenic
913756812 1:122084792-122084814 AAACCTGAACTATCAGAGAAAGG - Intergenic
913756821 1:122084962-122084984 AAACCTGAACTATCAGAGAAAGG - Intergenic
913758997 1:122110022-122110044 AAACCTGAACTATCAGAGAAAGG - Intergenic
913759622 1:122117491-122117513 AAACCTGAACTATCAGAGAAAGG - Intergenic
913761933 1:122143958-122143980 AAACCTGAACTATCAGAGAAAGG - Intergenic
913762590 1:122151419-122151441 AAACCTGAACTATCAGAGAAAGG - Intergenic
913764034 1:122168211-122168233 AAACCTGAACTATCAGAGAAAGG - Intergenic
913765918 1:122190305-122190327 AAACCTGAACTATCAGAGAAAGG - Intergenic
913765928 1:122190475-122190497 AAACCTGAACTATCAGAGAAAGG - Intergenic
913766087 1:122192341-122192363 AAACCTGAACTATCAGAGAAAGG - Intergenic
913768945 1:122225540-122225562 AAACCTGAACTATCAGAGAAAGG - Intergenic
913769090 1:122227407-122227429 AAACCTGAACTATCAGAGAAAGG - Intergenic
913769409 1:122231649-122231671 AAACCTGAACTATCAGAGAAAGG - Intergenic
913769548 1:122233516-122233538 AAACCTGAACTATCAGAGAAAGG - Intergenic
913769679 1:122235383-122235405 AAACCTGAACTATCAGAGAAAGG - Intergenic
913769956 1:122239199-122239221 AAACCTGAACTATCAGAGAAAGG - Intergenic
913770095 1:122241064-122241086 AAACCTGAACTATCAGAGAAAGG - Intergenic
913770233 1:122242931-122242953 AAACCTGAACTATCAGAGAAAGG - Intergenic
913770655 1:122248529-122248551 AAACCTGAACTATCAGAGAAAGG - Intergenic
913770796 1:122250395-122250417 AAACCTGAACTATCAGAGAAAGG - Intergenic
913770939 1:122252262-122252284 AAACCTGAACTATCAGAGAAAGG - Intergenic
913771078 1:122254129-122254151 AAACCTGAACTATCAGAGAAAGG - Intergenic
913771218 1:122255995-122256017 AAACCTGAACTATCAGAGAAAGG - Intergenic
913771358 1:122257861-122257883 AAACCTGAACTATCAGAGAAAGG - Intergenic
913771498 1:122259726-122259748 AAACCTGAACTATCAGAGAAAGG - Intergenic
913771638 1:122261592-122261614 AAACCTGAACTATCAGAGAAAGG - Intergenic
913771680 1:122262266-122262288 AAACCTGAACTATCAGAGAAAGG - Intergenic
913771958 1:122265998-122266020 AAACCTGAACTATCAGAGAAAGG - Intergenic
913772096 1:122267864-122267886 AAACCTGAACTATCAGAGAAAGG - Intergenic
913772233 1:122269729-122269751 AAACCTGAACTATCAGAGAATGG - Intergenic
913772369 1:122271594-122271616 AAACCTGAACTATCAGAGAAAGG - Intergenic
913772511 1:122273461-122273483 AAACCTGAACTATCAGAGAAAGG - Intergenic
913772652 1:122275327-122275349 AAACCTGAACTATCAGAGAAAGG - Intergenic
913772792 1:122277193-122277215 AAACCTGAACTATCAGAGAAAGG - Intergenic
913772930 1:122279059-122279081 AAACCTGAACTATCAGAGAAAGG - Intergenic
913773070 1:122280926-122280948 AAACCTGAACTATCAGAGAAAGG - Intergenic
913773206 1:122282792-122282814 AAACCTGAACTATCAGAGAAAGG - Intergenic
913773346 1:122284657-122284679 AAACCTGAACTATCAGAGAAAGG - Intergenic
913773489 1:122286523-122286545 AAACCTGAACTATCAGAGAAAGG - Intergenic
913773628 1:122288389-122288411 AAACCTGAACTATCAGAGAAAGG - Intergenic
913773768 1:122290255-122290277 AAACCTGAACTATCAGAGAAAGG - Intergenic
913774049 1:122293987-122294009 AAACCTGAACTATCAGAGAAAGG - Intergenic
913774186 1:122295853-122295875 AAACCTGAACTATCAGAGAAAGG - Intergenic
913774324 1:122297719-122297741 AAACCTGAACTATCAGAGAAAGG - Intergenic
913774605 1:122301451-122301473 AAACCTGAACTATCAGAGAAAGG - Intergenic
913774744 1:122303317-122303339 AAACCTGAACTATCAGAGAAAGG - Intergenic
913774883 1:122305183-122305205 AAACCTGAACTATCAGAGAAAGG - Intergenic
913775022 1:122307049-122307071 AAACCTGAACTATCAGAGAAAGG - Intergenic
913775297 1:122310781-122310803 AAACCTGAACTATCAGAGAAAGG - Intergenic
913775436 1:122312647-122312669 AAACCTGAACTATCAGAGAAAGG - Intergenic
913775576 1:122314513-122314535 AAACCTGAACTATCAGAGAAAGG - Intergenic
913775714 1:122316379-122316401 AAACCTGAACTATCAGAGAAAGG - Intergenic
913775852 1:122318246-122318268 AAACCTGAACTATCAGAGAAAGG - Intergenic
913776135 1:122321979-122322001 AAACCTGAACTATCAGAGAAAGG - Intergenic
913776277 1:122323845-122323867 AAACCTGAACTATCAGAGAAAGG - Intergenic
913776419 1:122325714-122325736 AAACCTGAACTATCAGAGAAAGG - Intergenic
913776559 1:122327579-122327601 AAACCTGAACTATCAGAGAAAGG - Intergenic
913776702 1:122329445-122329467 AAACCTGAACTATCAGAGAAAGG - Intergenic
913776842 1:122331310-122331332 AAACCTGAACTATCAGAGAAAGG - Intergenic
913776983 1:122333177-122333199 AAACCTGAACTATCAGAGAAAGG - Intergenic
913777121 1:122335043-122335065 AAACCTGAACTATCAGAGAAAGG - Intergenic
913777261 1:122336908-122336930 AAACCTGAACTATCAGAGAAAGG - Intergenic
913777401 1:122338774-122338796 AAACCTGAACTATCAGAGAAAGG - Intergenic
913777536 1:122340626-122340648 AAACCTGAACTATCAGAGAAAGG - Intergenic
913777678 1:122342492-122342514 AAACCTGAACTATCAGAGAAAGG - Intergenic
913777815 1:122344361-122344383 AAACCTGAACTATCAGAGAAAGG - Intergenic
913777955 1:122346227-122346249 AAACCTGAACTATCAGAGAAAGG - Intergenic
913778240 1:122349955-122349977 AAACCTGAACTATCAGAGAAAGG - Intergenic
913778378 1:122351820-122351842 AAACCTGAACTATCAGAGAAAGG - Intergenic
913778521 1:122353686-122353708 AAACCTGAACTATCAGAGAAAGG - Intergenic
913778661 1:122355552-122355574 AAACCTGAACTATCAGAGAAAGG - Intergenic
913778796 1:122357417-122357439 AAACCTGAACTATCAGAGAAAGG - Intergenic
913778935 1:122359283-122359305 AAACCTGAACTATCAGAGAAAGG - Intergenic
913779074 1:122361148-122361170 AAACCTGAACTATCAGAGAAAGG - Intergenic
913779219 1:122363016-122363038 AAACCTGAACTATCAGAGAAAGG - Intergenic
913779361 1:122364882-122364904 AAACCTGAACTATCAGAGAAAGG - Intergenic
913779497 1:122366749-122366771 AAACCTGAACTATCAGAGAAAGG - Intergenic
913779630 1:122368614-122368636 AAACCTGAACTATCAGAGAAAGG - Intergenic
913779774 1:122370480-122370502 AAACCTGAACTATCAGAGAAAGG - Intergenic
913780055 1:122374213-122374235 AAACCTGAACTATCAGAGAAAGG - Intergenic
913780191 1:122376078-122376100 AAACCTGAACTATCAGAGAAAGG - Intergenic
913780333 1:122377944-122377966 AAACCTGAACTATCAGAGAAAGG - Intergenic
913780471 1:122379809-122379831 AAACCTGAACTATCAGAGAAAGG - Intergenic
913780611 1:122381675-122381697 AAACCTGAACTATCAGAGAAAGG - Intergenic
913780750 1:122383543-122383565 AAACCTGAACTATCAGAGAAAGG - Intergenic
913780892 1:122385408-122385430 AAACCTGAACTATCAGAGAAAGG - Intergenic
913781185 1:122389146-122389168 AAACCTGAACTATCAGAGAAAGG - Intergenic
913781320 1:122391012-122391034 AAACCTGAACTATCAGAGAAAGG - Intergenic
913781458 1:122392878-122392900 AAACCTGAACTATCAGAGAAAGG - Intergenic
913781735 1:122396610-122396632 AAACCTGAACTATCAGAGAAAGG - Intergenic
913781875 1:122398476-122398498 AAACCTGAACTATCAGAGAAAGG - Intergenic
913782016 1:122400342-122400364 AAACCTGAACTATCAGAGAAAGG - Intergenic
913782154 1:122402206-122402228 AAACCTGAACTATCAGAGAAAGG - Intergenic
913782295 1:122404073-122404095 AAACCTGAACTATCAGAGAAAGG - Intergenic
913782582 1:122407807-122407829 AAACCTGAACTATCAGAGAAAGG - Intergenic
913782720 1:122409673-122409695 AAACCTGAACTATCAGAGAAAGG - Intergenic
913782860 1:122411540-122411562 AAACCTGAACTATCAGAGAAAGG - Intergenic
913783004 1:122413406-122413428 AAACCTGAACTATCAGAGAAAGG - Intergenic
913783272 1:122416970-122416992 AAACCTGAACTATCAGAGAAAGG - Intergenic
913783282 1:122417140-122417162 AAACCTGAACTATCAGAGAAAGG - Intergenic
913783421 1:122419006-122419028 AAACCTGAACTATCAGAGAAAGG - Intergenic
913783556 1:122420872-122420894 AAACCTGAACTATCAGAGAAAGG - Intergenic
913783835 1:122424604-122424626 AAACCTGAACTATCAGAGAAAGG - Intergenic
913783971 1:122426470-122426492 AAACCTGAACTATCAGAGAAAGG - Intergenic
913784371 1:122431729-122431751 AAACCTGAACTATCAGAGAAAGG - Intergenic
913784512 1:122433596-122433618 AAACCTGAACTATCAGAGAAAGG - Intergenic
913784650 1:122435462-122435484 AAACCTGAACTATCAGAGAAAGG - Intergenic
913784787 1:122437327-122437349 AAACCTGAACTATCAGAGAAAGG - Intergenic
913784924 1:122439193-122439215 AAACCTGAACTATCAGAGAAAGG - Intergenic
913785064 1:122441059-122441081 AAACCTGAACTACCAGAGAAAGG - Intergenic
913785205 1:122442925-122442947 AAACCTGAACTATCAGAGAAAGG - Intergenic
913785484 1:122446657-122446679 AAACCTGAACTATCAGAGAAAGG - Intergenic
913785628 1:122448525-122448547 AAACCTGAACTATCAGAGAAAGG - Intergenic
913785769 1:122450391-122450413 AAACCTGAACTATCAGAGAAAGG - Intergenic
913785780 1:122450561-122450583 AAACCTGAACTATCAGAGAAAGG - Intergenic
913785923 1:122452428-122452450 AAACCTGAACTATCAGAGAAAGG - Intergenic
913786337 1:122458025-122458047 AAACCTGAACTATCAGAGAAAGG - Intergenic
913786482 1:122459891-122459913 AAACCTGAACTATCAGAGAAAGG - Intergenic
913786624 1:122461757-122461779 AAACCTGAACTATCAGAGAAAGG - Intergenic
913786773 1:122463820-122463842 AAACCTGAACTATCAGAGAAAGG - Intergenic
913786911 1:122465686-122465708 AAACCTGAACTATCAGAGAAAGG - Intergenic
913787048 1:122467553-122467575 AAACCTGAACTATCAGAGAAAGG - Intergenic
913787182 1:122469418-122469440 AAACCTGAACTATCAGAGAAAGG - Intergenic
913787323 1:122471283-122471305 AAACCTGAACTATCAGAGAAAGG - Intergenic
913787460 1:122473148-122473170 AAACCTGAACTATCAGAGAAAGG - Intergenic
913787738 1:122476879-122476901 AAACCTGAACTATCAGAGAAAGG - Intergenic
913787876 1:122478746-122478768 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788013 1:122480613-122480635 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788155 1:122482477-122482499 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788298 1:122484342-122484364 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788437 1:122486208-122486230 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788575 1:122488075-122488097 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788713 1:122489940-122489962 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788853 1:122491806-122491828 AAACCTGAACTATCAGAGAAAGG - Intergenic
913788992 1:122493672-122493694 AAACCTGAACTATCAGAGAAAGG - Intergenic
913789131 1:122495538-122495560 AAACCTGAACTATCAGAGAAAGG - Intergenic
913789264 1:122497431-122497453 AAACCTGAACTATCAGAGAAAGG - Intergenic
913789407 1:122499297-122499319 AAACCTGAACTATCAGAGAAAGG - Intergenic
913789550 1:122501164-122501186 AAACCTGAACTATCAGAGAAAGG - Intergenic
917783370 1:178424708-178424730 CACCCTGGCCTCCCAGAGTCTGG + Intronic
919452497 1:197788110-197788132 AAACCTGGCGCTCCAGGGACTGG + Intergenic
924652173 1:245939653-245939675 AACCCTGGCCTAGAGGAGACAGG + Intronic
924759606 1:246971628-246971650 AAACCAGGCCAAACAGAGATAGG - Intronic
1070266104 10:74904674-74904696 AAGCCTGGACTCCCAAAGACTGG - Intronic
1070400680 10:76050957-76050979 AAGCAAGGCCAACCAGAGACTGG - Intronic
1071840862 10:89470043-89470065 GAACCTGGCTTACCAGAAAGGGG - Intronic
1075316696 10:121459021-121459043 ACACCTGCCCTCCCAAAGACAGG + Intergenic
1075741641 10:124699751-124699773 AAGCCTGGCTGACCAGACACTGG + Intronic
1075927971 10:126268687-126268709 AAACATGGCCAATCACAGACAGG + Intronic
1077465275 11:2730971-2730993 AAAGCTGGGCTCCCAGAGAGCGG - Intronic
1078196612 11:9142032-9142054 AAAACTGGCATACAAGAGCCCGG - Exonic
1080121332 11:28681185-28681207 AAAGCAGGCCTACCAGATCCCGG - Intergenic
1081907484 11:46678992-46679014 AAACCCGGGCTACCAGAGAAGGG + Exonic
1083194885 11:61079958-61079980 AAGCCTGGCCTGGCAGAGAGGGG - Intergenic
1083789751 11:64976856-64976878 AAATCTGACCAGCCAGAGACTGG + Intergenic
1083873535 11:65507347-65507369 AACCCAGACCTACCAGAGAGAGG + Intergenic
1084752352 11:71212791-71212813 AAACCTCTCCTACCAGAGCAGGG - Intronic
1086065526 11:82739749-82739771 ATGCCTGGCCAACCAGAGACAGG - Intergenic
1088313565 11:108485159-108485181 AAGCTTGGGCTACCAGAAACAGG - Intronic
1098840388 12:75470708-75470730 AAACCTGAACTACAAGAGACAGG + Intergenic
1099143189 12:79006201-79006223 CAAGTTGGCCTGCCAGAGACAGG - Intronic
1102771445 12:115480665-115480687 AACTGTGGCCTACCAGAGACTGG - Intergenic
1103641315 12:122354852-122354874 CAAGCTGGCCTAACACAGACAGG + Intronic
1107870745 13:44744428-44744450 AAACCAGCCCTAACAGAGAGAGG - Intergenic
1109335985 13:60994309-60994331 AAATGTGGCTTACCAGAGGCTGG - Intergenic
1112602208 13:100868220-100868242 ATACCTGGCCTCACAGAGCCTGG - Intergenic
1116074178 14:40088976-40088998 AAACCTGTTTTATCAGAGACTGG + Intergenic
1118443566 14:65832566-65832588 AAACCAGGCCTACCAAAGCCTGG - Intergenic
1119088627 14:71759923-71759945 AACCCTGTCCCACCAGACACAGG + Intergenic
1120896342 14:89536196-89536218 AAACCAGGCCTACCAGATTTTGG - Intronic
1122756057 14:103980902-103980924 AAACCAGGCCATACAGAGACAGG - Intronic
1123924196 15:25092127-25092149 AAACCTGGCCACACAGAGGCGGG - Intergenic
1124201121 15:27679296-27679318 ACACCTGGCCTCGCAGAGAGAGG - Intergenic
1127538573 15:59914757-59914779 AAACTAGGACTACCAAAGACAGG - Intergenic
1128062231 15:64742458-64742480 AAAGCTGGGTTCCCAGAGACTGG + Intronic
1129381588 15:75171099-75171121 AAACCTGACCTATGAGAAACAGG - Intergenic
1132309920 15:100849889-100849911 AAACCTGGTCTCCCGGAGCCAGG + Intergenic
1135875588 16:26197024-26197046 AAACGTGGGCTACCAGAGAAAGG - Intergenic
1136014408 16:27386110-27386132 AAAATGTGCCTACCAGAGACTGG - Intergenic
1136319131 16:29471197-29471219 AAACCAGGCCATACAGAGACAGG + Intergenic
1136433702 16:30210541-30210563 AAACCAGGCCATACAGAGACAGG + Intergenic
1138652829 16:58471568-58471590 AAACCTGGTCTCACAGAGCCAGG + Intronic
1140113194 16:72020992-72021014 AAACCTGACCTGCCCGACACCGG - Intronic
1141754819 16:85983964-85983986 CCACCTGGTCTACCAGGGACTGG - Intergenic
1142364244 16:89641450-89641472 AAACCAGGCCATACAGAGACAGG - Intergenic
1145424552 17:22878677-22878699 AAACCTGAACTACCAAAGAAAGG - Intergenic
1145447603 17:23197112-23197134 AAACCTGAACTACCAAAGAAAGG - Intergenic
1145481291 17:23687272-23687294 AAACCTGACCTATCAAAGAAAGG - Intergenic
1145573742 17:25032470-25032492 AAACCTGAACTATCAGAGAAAGG - Intergenic
1145600717 17:25425416-25425438 AAACCTGACCTATCAAAGAAAGG - Intergenic
1145653602 17:26193620-26193642 AAACCTGAACTATCAAAGACAGG - Intergenic
1145978673 17:28998717-28998739 ACACCTGACCTGCCAGAGATAGG + Intronic
1150018338 17:61583541-61583563 ATACCAGGGCTACCAGAGACAGG - Intergenic
1152140690 17:78534719-78534741 CAGCCTGGCATACCAGAGGCAGG + Intronic
1156937068 18:42722505-42722527 AAGCCTGACCTACTAGAGAGGGG + Intergenic
1157557716 18:48623431-48623453 AACCCTGGCCTTCCTGAGAGTGG - Intronic
1163385932 19:17000578-17000600 CAACCTGGCCTTCCTGAGGCTGG - Intronic
1165369229 19:35392444-35392466 AAACCGTGCCTAGCACAGACTGG + Intergenic
1166258018 19:41619781-41619803 AGTCCTGGCCGATCAGAGACAGG - Intronic
1166283667 19:41810764-41810786 AATCCTGGCCAATCAGAGACAGG + Intronic
1166290627 19:41860920-41860942 AAGCCTCGCCTGCCAGGGACCGG - Intronic
1167400677 19:49266442-49266464 AAACCAGGCCATACAGAGACAGG + Intergenic
1167612491 19:50514148-50514170 CAACCTGGCCGGCCAGAGAGGGG - Intronic
1167693746 19:51002269-51002291 AAACCTGCCCTCCCAGATCCCGG - Intronic
925022680 2:584076-584098 AAGCCTGACCTAACACAGACGGG - Intergenic
926020432 2:9490374-9490396 AAAACTGGACCACCAGAGAATGG - Exonic
927252469 2:21009241-21009263 AAACCTGGCCTACCAGAGACAGG + Exonic
928814017 2:35267578-35267600 AAACCGTGGTTACCAGAGACTGG - Intergenic
929015742 2:37492850-37492872 AAAACTGGCTAACCAGAAACTGG - Intergenic
929707900 2:44235002-44235024 AAACCTGGCCTCACACAGATAGG + Intronic
930548553 2:52801282-52801304 AAACGTGGCCTATCACAGAAAGG - Intergenic
931648299 2:64445465-64445487 AAATCTAGCCTACAAAAGACAGG + Intergenic
935410579 2:102757723-102757745 AGAACTGAACTACCAGAGACTGG + Intronic
940460337 2:153956781-153956803 AATCCTAGCCCACCAGACACTGG + Intronic
941132465 2:161670511-161670533 AAACCTGGCCAAGCACAGAAAGG - Intronic
941497621 2:166225837-166225859 ACACCTGGGCTACCAGAAGCTGG + Intronic
947606657 2:231490308-231490330 AAACCAGGCCTTACAGAGATAGG - Intergenic
948227855 2:236325930-236325952 TAAACTGGCATACAAGAGACAGG - Intronic
1169436296 20:5594680-5594702 AAACCTGTCTTAGCAGAGCCAGG - Intronic
1169594909 20:7187517-7187539 AAACCTGGCAATACAGAGACTGG - Intergenic
1173079298 20:39850543-39850565 CACCCTTGCCTACCAGAGATTGG - Intergenic
1174873005 20:54200952-54200974 AAAACTGGCCTCCCACTGACTGG - Intergenic
1176007375 20:62873742-62873764 AAACCAGGCCATACAGAGACAGG + Intergenic
1185328694 22:50241184-50241206 AAACCAGGCCATACAGAGACAGG + Intronic
954681911 3:52350427-52350449 GAACCTGGCTCCCCAGAGACGGG - Intronic
955716620 3:61836456-61836478 AAAGCTGGCCTCCAGGAGACAGG - Intronic
962921603 3:139955382-139955404 AAACCTGGCATACAAGAGGCTGG + Intronic
963072479 3:141316011-141316033 AAATCTGGTCTACCAGAGATAGG - Intergenic
967765520 3:193275174-193275196 CAACCTGGCCTCCCATAAACAGG - Exonic
974486485 4:62512502-62512524 AAACCTTCCCTGCCAGAGAGGGG + Intergenic
976183735 4:82424243-82424265 AAAAATGGCTTTCCAGAGACAGG + Exonic
977531828 4:98209343-98209365 AAACCTGGCCTTCCATAAAAGGG + Intergenic
977702717 4:100037969-100037991 AAACCTGTCATACCAGAGATTGG + Intergenic
982324850 4:154119757-154119779 AAAGCTGGCACCCCAGAGACTGG + Intergenic
984929926 4:184837875-184837897 AAACCTGGTCTCCCCGAGCCTGG - Intergenic
985091052 4:186363109-186363131 AAACCAGGCCATACAGAGACAGG + Intergenic
987093847 5:14531036-14531058 AAACATGGCTTTACAGAGACAGG - Intronic
987657026 5:20820564-20820586 TAACCTGGCCTACCTTAAACAGG - Intergenic
988766524 5:34383384-34383406 TAACCTGGCCTACCTTAAACAGG + Intergenic
994524640 5:100888372-100888394 GAACCTGGCCTACAAAAGTCTGG + Intronic
997661475 5:135592301-135592323 AAGCCTGGCCTATCAGGAACAGG + Intergenic
997717513 5:136053110-136053132 AGGCCTGGCCTACCTGAGTCTGG - Exonic
999426950 5:151496354-151496376 ATACCAGACATACCAGAGACTGG - Intergenic
1001550759 5:172600849-172600871 CTGCCTGGCCTACCAGAGGCGGG + Intergenic
1004231910 6:13841420-13841442 AATCCTGCCAAACCAGAGACAGG + Intergenic
1005011726 6:21342237-21342259 AAACCTTGGGGACCAGAGACAGG + Intergenic
1005709683 6:28491252-28491274 AAACCAGGCCTTACAGAGATAGG + Intergenic
1005722694 6:28618444-28618466 AAACCTGGCCTGCCACATAGTGG + Intergenic
1007308194 6:40923532-40923554 AGACCTGGCCTACAGGAGGCGGG - Intergenic
1008336180 6:50307411-50307433 AAAGCTGGCTTGTCAGAGACAGG + Intergenic
1010563727 6:77383288-77383310 ACCCCTCCCCTACCAGAGACAGG - Intergenic
1011237909 6:85238089-85238111 AAACCTGCCCTCCCAGTGATGGG + Intergenic
1013470224 6:110457665-110457687 AAACCAGGCCATACAGAGACAGG + Intronic
1013608901 6:111775755-111775777 GATCCTGGCCTACCCCAGACTGG - Intronic
1016521408 6:144950961-144950983 AAACTTGGCCTTCCAGAGTAGGG + Intergenic
1016989145 6:149917499-149917521 AAACCAGGCCATGCAGAGACAGG - Intronic
1018692737 6:166362129-166362151 AGAGCTTGCCTTCCAGAGACTGG - Intergenic
1020049708 7:5073248-5073270 CAGCCTGGCCTACCAGGCACGGG - Intergenic
1024803774 7:53111734-53111756 CCACCTGGGCTACCTGAGACCGG + Intergenic
1026191088 7:68128418-68128440 AAACCTAGAGTACCAGAGAGGGG - Intergenic
1027199600 7:76055031-76055053 AATCCTGGCCTACTGGGGACAGG - Intronic
1027813287 7:82933343-82933365 AAACCTGACCTTCCAGAAAATGG - Intronic
1029312349 7:99679074-99679096 AATCCTAGCCTCCCAGAGACGGG + Intronic
1029314488 7:99699204-99699226 AATGCTAGCCTCCCAGAGACGGG + Intronic
1029320129 7:99751664-99751686 AATGCTAGCCTCCCAGAGACGGG + Intergenic
1033771034 7:144552023-144552045 AAAAATGAGCTACCAGAGACTGG - Intronic
1035871033 8:3136341-3136363 GAACCTGGGAGACCAGAGACCGG - Intronic
1036390554 8:8320866-8320888 AAACCTGGCATACAAGAGCTTGG + Intronic
1039277423 8:35948773-35948795 TACCCTGGCCTACTCGAGACAGG - Intergenic
1039659285 8:39445825-39445847 AACTCAGGCCTACTAGAGACTGG + Intergenic
1040837964 8:51752529-51752551 AGACCTGGCCTGCCACAGAAGGG + Intronic
1042477612 8:69266706-69266728 AAGCCTGGCCTTGCAGAGACTGG + Intergenic
1045305556 8:100953189-100953211 AAACCTAGCCTACGAGAAACGGG - Intronic
1045355646 8:101386557-101386579 AAACCGGGCCTACCATATTCTGG - Intergenic
1046958932 8:120089295-120089317 CAACCTATCCTACGAGAGACAGG - Intronic
1047655082 8:126968783-126968805 TAACCTGCCCTACCAGAGCCAGG + Intergenic
1048581596 8:135733596-135733618 AACCCTGGCTTAACAGAGAAAGG - Intergenic
1049507590 8:143011888-143011910 AAACCTGGCATGCCAGCAACAGG - Intergenic
1049951741 9:651410-651432 AAACGTGGCCTAACAGTGGCAGG + Intronic
1050879901 9:10686435-10686457 AAAACTGGCTTTCCTGAGACTGG + Intergenic
1054736089 9:68751386-68751408 AAACCTTGCCTGCCAAAGAAGGG + Intronic
1054838448 9:69706531-69706553 AAACTTGGCCTCCCAGTGATGGG + Intergenic
1056710475 9:88988876-88988898 AAAACTGGACTACCAGAGTGTGG - Intergenic
1058176687 9:101743420-101743442 AAACTTGGCCCATCACAGACTGG + Intergenic
1060600924 9:124876803-124876825 GAGCCTGGCTTGCCAGAGACAGG - Intronic
1185977841 X:4741221-4741243 AGACCTGGCCTGCCACAGAATGG + Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1186824684 X:13327961-13327983 AAACCTAGCCTATCTGAGATTGG - Intergenic
1188955731 X:36433402-36433424 AAACCAGGCCATACAGAGACAGG - Intergenic
1189239186 X:39512518-39512540 AAACCAGACCTACCAGGGGCAGG - Intergenic
1190280322 X:48924939-48924961 AAACAGGGCCTGCCACAGACTGG + Intronic
1191784858 X:64906358-64906380 AAACCTGAGCTCCCAGAGAACGG - Intergenic
1194739861 X:97559842-97559864 AATCCTGACCTACCAGAAATTGG + Intronic
1197243245 X:124142485-124142507 AAACCTGGCCTGCCAGCAAAAGG - Intronic