ID: 927254644

View in Genome Browser
Species Human (GRCh38)
Location 2:21029650-21029672
Sequence GCTCCATTTTCCGCAGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927254641_927254644 8 Left 927254641 2:21029619-21029641 CCTCTTCTTGTGGACTTTACCTT 0: 1
1: 0
2: 3
3: 31
4: 229
Right 927254644 2:21029650-21029672 GCTCCATTTTCCGCAGAGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927254644 Original CRISPR GCTCCATTTTCCGCAGAGCC TGG Exonic
900467075 1:2831077-2831099 CCTCCAGATTCCTCAGAGCCTGG + Intergenic
901898470 1:12336414-12336436 GCTCTGTTTTCCTCAGAGCTGGG + Intronic
901924292 1:12556255-12556277 GCTCCAGGTCCCACAGAGCCAGG + Intergenic
903630055 1:24761673-24761695 AATTCATTTTCCACAGAGCCAGG - Intronic
914049925 1:144123114-144123136 TCTCCATTTTCCCCACAACCTGG + Intergenic
914129257 1:144842337-144842359 TCTCCATTTTCCCCACAACCTGG - Intergenic
915684585 1:157618562-157618584 GCCCCAGCTGCCGCAGAGCCTGG - Intergenic
920679505 1:208061746-208061768 GCTACATTTTTCCAAGAGCCTGG - Intronic
923535070 1:234843056-234843078 GCTGGGCTTTCCGCAGAGCCAGG + Intergenic
1063251568 10:4280522-4280544 GCCCCATTCTCCCCAGAGGCTGG - Intergenic
1066321831 10:34310373-34310395 ATTCCATTTTCCACACAGCCTGG + Intronic
1071930622 10:90465742-90465764 GCTCCTCTTTCCTCTGAGCCAGG + Intergenic
1072151734 10:92689829-92689851 GCGCCATTGGCCGCAGGGCCCGG + Intergenic
1073030191 10:100519695-100519717 GCTCCTTTCTCGGCAGAGCGCGG - Intronic
1074980637 10:118617137-118617159 GCTACATTTTTAGTAGAGCCAGG + Intergenic
1075680064 10:124325299-124325321 TCTCCAGGTTCCTCAGAGCCAGG + Intergenic
1076491912 10:130867459-130867481 GCTCCATCGTCAGCAGAGCCAGG - Intergenic
1077178799 11:1203208-1203230 GCTCCAGGCACCGCAGAGCCAGG + Intergenic
1078050388 11:7960708-7960730 GCTCCAGATTCCTCAAAGCCAGG + Exonic
1079304754 11:19312161-19312183 GCACCATCCTCAGCAGAGCCGGG + Intergenic
1081854974 11:46297177-46297199 GCTACACCCTCCGCAGAGCCCGG - Intronic
1083619566 11:64042248-64042270 GCTTCATTCACCTCAGAGCCTGG - Intronic
1083641745 11:64149401-64149423 GCTCCATTTGCACCAGGGCCAGG - Intronic
1083789724 11:64976758-64976780 GCTCCATTTCCTGCAGCACCTGG + Intergenic
1090057705 11:123437840-123437862 GCTCCATTTCCAGGAGAGCAGGG + Intergenic
1091273310 11:134332570-134332592 GCGCCTTATTCCGCAGAGGCCGG + Intronic
1091532608 12:1374226-1374248 GCTCCATTTGCTGGAAAGCCTGG - Intronic
1094476609 12:30845467-30845489 GATCCATTTTTCGGGGAGCCAGG + Intergenic
1101823559 12:108202881-108202903 GGTCCATCTTCCCCAAAGCCTGG - Intronic
1104069382 12:125331116-125331138 GCTCCCTCCTCCGCAGACCCCGG - Intronic
1106620124 13:31364744-31364766 GCTGCATATTCCATAGAGCCGGG + Intergenic
1110132337 13:72023058-72023080 GCTCTATGTACCGCAGTGCCTGG - Intergenic
1113764059 13:112869902-112869924 GCCCCAATGTCAGCAGAGCCCGG - Intronic
1114627086 14:24136772-24136794 ACTCCACTTTCCGTAGATCCAGG + Intronic
1114653962 14:24304847-24304869 CCTCCATTTCCCCCAGACCCTGG - Intronic
1123419790 15:20122359-20122381 TCTCCATTTTCCCCACAACCTGG + Intergenic
1123446070 15:20331174-20331196 TCTCCATTTTCCCCACAACCTGG - Intergenic
1123529012 15:21128895-21128917 TCTCCATTTTCCCCACAACCTGG + Intergenic
1124953331 15:34343188-34343210 ACTACATTTTCCGGAGTGCCAGG - Intergenic
1128137110 15:65272034-65272056 GCTCCATTTTCCTCAGAGGCTGG - Intronic
1129799857 15:78405745-78405767 GCTGCATGCTCCACAGAGCCAGG + Intergenic
1130965822 15:88696681-88696703 GCTCTATTTTCTGGACAGCCAGG + Intergenic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1133467828 16:6044810-6044832 GGTCCATTGTCTGCAGAGCTAGG + Intronic
1136056719 16:27695276-27695298 TCCCCATTTCCCGCAGAGCATGG + Intronic
1136720696 16:32317501-32317523 TCTCCATTTTCCCCACAACCTGG + Intergenic
1136839078 16:33523783-33523805 TCTCCATTTTCCCCACAACCTGG + Intergenic
1203005736 16_KI270728v1_random:200269-200291 TCTCCATTTTCCCCACAACCTGG - Intergenic
1203137285 16_KI270728v1_random:1736389-1736411 TCTCCATTTTCCCCACAACCTGG - Intergenic
1203149241 16_KI270728v1_random:1824070-1824092 TCTCCATTTTCCCCACAACCTGG + Intergenic
1143894197 17:10123839-10123861 CCTCCATCTTGAGCAGAGCCTGG + Intronic
1144500879 17:15786302-15786324 GCTCGATTCCCCGCAGAGCCGGG + Intergenic
1145163041 17:20588964-20588986 GTTCGATTCCCCGCAGAGCCGGG + Intergenic
1145239117 17:21229423-21229445 GCTCCGTTTCCAGCAGAGGCTGG + Intergenic
1147836093 17:43332855-43332877 GCTCCAATTTCTACACAGCCCGG - Intergenic
1147911451 17:43858509-43858531 CCTCCCTCTTCAGCAGAGCCAGG - Intronic
1148901998 17:50885249-50885271 GTTCCATTTTGCCCAAAGCCAGG + Intergenic
1149263475 17:54902687-54902709 TCTCCATTTCCCCCAGAACCCGG + Intronic
1151246313 17:72797689-72797711 GCTCCATCCTCTGCAGAGCCGGG - Intronic
1151560589 17:74867565-74867587 GCTCCCCTTTCCCCAGAGCATGG - Intronic
1151884997 17:76918289-76918311 ACTCCCTTTTCCTCTGAGCCAGG + Intronic
1152407424 17:80105580-80105602 GCTCCCTCATCTGCAGAGCCAGG - Intergenic
1153232684 18:2955096-2955118 GTTCCATTTTCCCAAGAACCAGG + Intronic
1154106766 18:11530549-11530571 CATCCATTTTCCCAAGAGCCTGG - Intergenic
1157929377 18:51804300-51804322 CATCCATATTCCCCAGAGCCAGG - Intergenic
1161159301 19:2753018-2753040 GCCCCAGTGTCCACAGAGCCGGG - Intergenic
1165038504 19:33052221-33052243 GCTCCATTCTGGGCAGTGCCTGG + Intronic
1165990842 19:39812509-39812531 GCCACATTATCTGCAGAGCCTGG - Intergenic
1168663223 19:58183523-58183545 TCTGCATTTTCCGCCGAGCTCGG + Intronic
1202689314 1_KI270712v1_random:75677-75699 TCTCCATTTTCCCCACAACCTGG + Intergenic
925412495 2:3648005-3648027 GCACCATCATCAGCAGAGCCTGG - Intergenic
926943104 2:18158791-18158813 GCTCAATTCTCTGCAGAGCTGGG + Intronic
927254644 2:21029650-21029672 GCTCCATTTTCCGCAGAGCCTGG + Exonic
933957120 2:87380414-87380436 TCTCCATTTTCCCCACAACCTGG - Intergenic
934241239 2:90272306-90272328 TCTCCATTTTCCCCACAACCTGG - Intergenic
934271937 2:91544380-91544402 TCTCCATTTTCCCCACAACCTGG + Intergenic
934663552 2:96155491-96155513 GCTCCATGCTCCCCAGATCCTGG + Intergenic
936147918 2:109993988-109994010 TCTCCATTTTCCCCACAACCTGG + Intergenic
936196773 2:110377459-110377481 TCTCCATTTTCCCCACAACCTGG - Intergenic
941843463 2:170111456-170111478 GCTCCATTTTGCCCAATGCCAGG - Intergenic
944279269 2:197876186-197876208 GCTCCATCTCCTGCAGAGGCAGG - Intronic
948763604 2:240208283-240208305 CCTCCATCCTCCGCAGAGCAAGG - Intergenic
1168979608 20:1993575-1993597 GTCCCATTTTCCCCAGACCCTGG + Intronic
1172004203 20:31806663-31806685 GCTCCTATTTCTGCAGAGGCAGG + Intergenic
1173616321 20:44405686-44405708 CCTGCATTTTCCCCAGAACCAGG - Intronic
1173737620 20:45373077-45373099 CCTCCATATTCCCCAGAGGCAGG - Exonic
1174300221 20:49576361-49576383 ACTCCATTTTTAGCAAAGCCAGG + Intergenic
1175495842 20:59413587-59413609 GCTCCAGTTTCAGCAGCCCCAGG + Intergenic
1175871159 20:62210158-62210180 GCTCCAGGATCCGCAGACCCTGG + Intergenic
1176241716 20:64078600-64078622 GCTGCATTTGCTGCAGAGCAGGG + Intronic
1180552106 22:16548937-16548959 TCTCCATTTTCCCCACAACCTGG - Intergenic
1181171250 22:21011498-21011520 GCTGCATCTTCCGCATGGCCTGG + Intronic
1181178095 22:21049021-21049043 GCTGCATCTTCCGCATGGCCTGG - Exonic
1181351922 22:22265122-22265144 TCTCCATTTTCCCCACAACCTGG + Intergenic
949168699 3:971995-972017 GCTCCACTTTCTTCTGAGCCTGG - Intergenic
949501108 3:4680731-4680753 TCCCCATTTTCCTTAGAGCCAGG - Intronic
949885794 3:8692753-8692775 TCTGCATTTTCAGCAGAGACAGG - Intronic
951803620 3:26623374-26623396 GATCCCTTTTGCGCAGACCCTGG + Intronic
956911809 3:73826004-73826026 GCTCACTTTTCCACAGTGCCAGG - Intergenic
957427054 3:80051884-80051906 TCTCCATTCTCCGCGGAGTCTGG - Intergenic
957556167 3:81766871-81766893 GGTCCATTTTACAGAGAGCCAGG + Intergenic
963109933 3:141679999-141680021 TCTCCTCTTTCCGCAGACCCTGG - Intergenic
964065623 3:152575129-152575151 GCTACAATTTCCTCAGAGCTTGG - Intergenic
966846932 3:184138027-184138049 TCTCCATTTTCAGAAGACCCAGG + Exonic
966917904 3:184594831-184594853 GCTCAGTTTTCCACAGAGTCAGG - Intronic
967814438 3:193787257-193787279 CCTCCAACTTCCCCAGAGCCAGG - Intergenic
969330346 4:6471014-6471036 GCCTCATTTCCGGCAGAGCCAGG + Intronic
970946429 4:21698220-21698242 GCTACATTTTCTGCACAGCGCGG + Intronic
975806735 4:78120564-78120586 GCCCCTTTTTCCCCAGAGCCTGG - Intronic
985952225 5:3231086-3231108 GCTCCAGGGACCGCAGAGCCTGG + Intergenic
986722195 5:10567302-10567324 ACTCCATTTACCACAGAGCAGGG - Intronic
987401078 5:17477510-17477532 GGTCCATTCTCAGAAGAGCCTGG + Intergenic
988905648 5:35785890-35785912 GCTCCATTTTCCCCTTTGCCTGG + Intronic
992738224 5:79745362-79745384 GGTCCACTTTCTGCAGAGCATGG + Exonic
994076224 5:95652885-95652907 AATCCATTCTCCACAGAGCCGGG + Intronic
994251390 5:97541480-97541502 GGTCCATTTTACAGAGAGCCCGG + Intergenic
995671549 5:114609763-114609785 GCTCTTTCTTCCCCAGAGCCAGG - Intergenic
996363826 5:122678837-122678859 TTTCCATTTTCTGCAGAGTCAGG - Intergenic
998331587 5:141332416-141332438 GCGCCCCTCTCCGCAGAGCCCGG + Exonic
998342757 5:141432491-141432513 GCTCCCCGCTCCGCAGAGCCCGG + Exonic
1002309799 5:178307461-178307483 GCTCCTCCTTCCCCAGAGCCAGG + Intronic
1002693247 5:181065615-181065637 TCTCCATATGCCGAAGAGCCAGG - Intergenic
1003023147 6:2529515-2529537 GTTCCATCTCCCCCAGAGCCTGG - Intergenic
1005042148 6:21609503-21609525 GGTCCATTTTACAGAGAGCCCGG + Intergenic
1005688768 6:28281631-28281653 GCGCCGGTTTCCCCAGAGCCCGG - Exonic
1006091393 6:31631188-31631210 GCTCCATTCTCAGGAAAGCCTGG - Exonic
1006134584 6:31887955-31887977 GCTCCTTCTTCCACAGTGCCCGG - Exonic
1007140238 6:39565449-39565471 TCTCCATTTTCCGCAAGCCCAGG + Intronic
1016934118 6:149436289-149436311 GCTCCAGTGTCTGCAGAGACAGG - Intergenic
1017116711 6:150984316-150984338 ACTCCTTTTTCTGCTGAGCCAGG - Intronic
1020006363 7:4785506-4785528 GGTCCATGTCCCGCAGTGCCTGG + Exonic
1021884587 7:25125940-25125962 GCTGCATTTGCGGCAGAGACAGG + Intergenic
1025145092 7:56495121-56495143 GCTCCATTTTCTATAGAGCAGGG + Intergenic
1028168670 7:87569040-87569062 TCTCCATTTTCGGCAGGGCATGG + Intronic
1029536795 7:101162119-101162141 GCTCCTTTTTCCCAAGATCCTGG - Intergenic
1033407617 7:141085695-141085717 GCTCCATTTCCCCAAGGGCCTGG + Intronic
1033508163 7:142026840-142026862 GCTGCTTTTTCCCCAGAACCTGG + Intronic
1034240525 7:149607209-149607231 TCTCCATTTCCCACAGTGCCTGG + Intergenic
1036295920 8:7537092-7537114 GCCCCATTTGCCCCAAAGCCAGG - Intergenic
1036326646 8:7783927-7783949 GCCCCATTTGCCCCAAAGCCAGG + Intergenic
1038797541 8:30723123-30723145 GCTCCCTTTGCCCCAGGGCCTGG - Intronic
1039649827 8:39329425-39329447 GATCCATTTTTCGGGGAGCCAGG - Intergenic
1042487418 8:69361705-69361727 GCTCCATTTTCCCCTAAGGCAGG - Intergenic
1042839958 8:73113645-73113667 TCTTCCTTTTCCCCAGAGCCTGG + Intronic
1043341064 8:79240240-79240262 ACTGCATTTTCCTCAGAGCAAGG + Intergenic
1047421337 8:124710520-124710542 CCTCCACTTTCCCTAGAGCCAGG + Intronic
1049269784 8:141688603-141688625 TCTCCCTTTTCCATAGAGCCTGG + Intergenic
1049593490 8:143472973-143472995 GCTCCAGCTTCCGCAGAGCAGGG + Intronic
1054330065 9:63743277-63743299 GCTACATTTTCCTTAAAGCCAGG + Intergenic
1056787900 9:89605736-89605758 GATCCATTTTACGCTGATCCAGG + Exonic
1057203349 9:93155717-93155739 GCAGCATTATCCACAGAGCCAGG - Intergenic
1057776003 9:98010176-98010198 CCACTATTTTCCGCAGTGCCTGG - Intronic
1058355608 9:104080688-104080710 GGTCCTTTTTCAGCATAGCCGGG + Intergenic
1191797827 X:65040947-65040969 GCTCTATTTTCAGTAGAGACCGG + Intergenic
1192097886 X:68232602-68232624 GCTACATTATTTGCAGAGCCAGG + Intronic
1199629003 X:149763049-149763071 CCTTCATTCTCTGCAGAGCCTGG + Intergenic
1200844458 Y:7817114-7817136 GTGCCATTTTAGGCAGAGCCAGG + Intergenic