ID: 927255168

View in Genome Browser
Species Human (GRCh38)
Location 2:21035016-21035038
Sequence TGGGTAAATCCAGCCATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927255167_927255168 -8 Left 927255167 2:21035001-21035023 CCATCTTTCAAAGCATGGGTAAA 0: 1
1: 0
2: 1
3: 15
4: 230
Right 927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 85
927255162_927255168 3 Left 927255162 2:21034990-21035012 CCAAGTCCTGCCCATCTTTCAAA 0: 2
1: 0
2: 2
3: 57
4: 349
Right 927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 85
927255161_927255168 4 Left 927255161 2:21034989-21035011 CCCAAGTCCTGCCCATCTTTCAA 0: 2
1: 0
2: 5
3: 51
4: 280
Right 927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 85
927255159_927255168 21 Left 927255159 2:21034972-21034994 CCCTGTCTCTGCATCTACCCAAG 0: 1
1: 0
2: 3
3: 26
4: 320
Right 927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 85
927255163_927255168 -3 Left 927255163 2:21034996-21035018 CCTGCCCATCTTTCAAAGCATGG 0: 1
1: 0
2: 1
3: 20
4: 161
Right 927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 85
927255166_927255168 -7 Left 927255166 2:21035000-21035022 CCCATCTTTCAAAGCATGGGTAA 0: 1
1: 0
2: 0
3: 17
4: 166
Right 927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 85
927255160_927255168 20 Left 927255160 2:21034973-21034995 CCTGTCTCTGCATCTACCCAAGT 0: 1
1: 0
2: 1
3: 18
4: 230
Right 927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927255168 Original CRISPR TGGGTAAATCCAGCCATTGT TGG Intronic
901190428 1:7406816-7406838 TGAGTAACTCTACCCATTGTCGG - Intronic
905477817 1:38241351-38241373 TGGGGAAGTCCAGCCATGGCAGG + Intergenic
909145385 1:71923742-71923764 TCATTAAATCCAGCCATTGTAGG + Intronic
910102608 1:83594545-83594567 TGGGAAAATTCAGTAATTGTAGG - Intergenic
911902216 1:103521170-103521192 TGGGAAACTCCAGCCTTTGGAGG + Intergenic
915121323 1:153631080-153631102 TGGGTAAATGCAGACATTTTAGG + Exonic
918410690 1:184255131-184255153 TGGGGAATTCCAGCTATTTTGGG + Intergenic
921394582 1:214654961-214654983 TGGATAAATACAGACATAGTGGG + Intronic
922424802 1:225482776-225482798 TGAGCAAATGCAGGCATTGTTGG - Intergenic
1068435578 10:56986942-56986964 TTGGTAAATCCAGCCTGTCTAGG + Intergenic
1073711668 10:106049975-106049997 TGGGTAATTCTACCCATTATAGG - Intergenic
1074897973 10:117793481-117793503 CTGGTAAATCCAGCCATGGCTGG + Intergenic
1075165461 10:120064197-120064219 GGGTTCAATCCAACCATTGTGGG + Intergenic
1077513020 11:2981456-2981478 TGAGCATAGCCAGCCATTGTAGG - Intronic
1077513343 11:2984200-2984222 TGAGCATAGCCAGCCATTGTAGG - Intronic
1080958614 11:37130872-37130894 TGGGTAAATACAGCCATTACAGG - Intergenic
1083720465 11:64601248-64601270 GAGGGAGATCCAGCCATTGTTGG + Intronic
1084088888 11:66867450-66867472 CGGGGAAATCCTGCCAGTGTAGG - Intronic
1088080976 11:105913587-105913609 TGGATAAATACAGCAATTGAGGG + Intronic
1091630336 12:2155043-2155065 TTGGTGAATCCTGGCATTGTGGG + Intronic
1098110427 12:67115721-67115743 GGGGCAAATCCAGACAATGTAGG + Intergenic
1100450092 12:94697441-94697463 TGGGTTAATGCTGCTATTGTAGG - Intergenic
1101319698 12:103662895-103662917 TGTGTAAATTCGGCCATTTTTGG - Exonic
1103701028 12:122848850-122848872 TGGGTAGGTCCAGCCATTCTAGG + Exonic
1105205511 13:18220177-18220199 TGGGTAATTCCAGGCATAGAGGG - Intergenic
1109389936 13:61680676-61680698 TGGGTAAATGCAGCCAATCTGGG - Intergenic
1116637852 14:47420044-47420066 TGGGTAAATTATGCCAGTGTGGG + Intronic
1119495191 14:75071736-75071758 TGGGTGAGTGCAGCCACTGTGGG + Exonic
1124794385 15:32762795-32762817 TGGGTAAATACAGCCGTTCCAGG + Intergenic
1125226212 15:37399308-37399330 TGGCCAAATACAGCCATTTTTGG - Intergenic
1133694984 16:8254491-8254513 TGGATAAATCCTGATATTGTAGG - Intergenic
1139550347 16:67669355-67669377 TGGGAAGAGCCAGCCAGTGTTGG + Intergenic
1140746177 16:77982438-77982460 TGGCTACATCCAGCCAGTGTTGG + Intergenic
1149125645 17:53227951-53227973 TTGGTAAGTGCAGACATTGTGGG - Intergenic
1152192587 17:78897533-78897555 TGGGTGAATCCACCCACAGTGGG + Intronic
1159055028 18:63454756-63454778 TGGGTAAATGGAGCCATGGGTGG - Intergenic
1167713257 19:51125111-51125133 AGGGTAAATCCAGCCATGCGAGG - Exonic
927255168 2:21035016-21035038 TGGGTAAATCCAGCCATTGTTGG + Intronic
927259110 2:21069179-21069201 TGGGTACTTCCAGCCAAGGTGGG - Intergenic
928980590 2:37132046-37132068 TGGGTAACTGCAGCCTTTTTTGG - Intronic
929308492 2:40394274-40394296 GGGGTGAATACAGCCATTCTAGG + Intronic
929806708 2:45152868-45152890 TGGGAAAACCCTGGCATTGTGGG + Intergenic
930471811 2:51825775-51825797 TGAGAAAATGCAGCTATTGTGGG + Intergenic
932697920 2:73972052-73972074 TGGACAAATCCAGGCATTTTTGG - Intergenic
933636350 2:84712794-84712816 TGGGTAGATTAAGTCATTGTGGG - Intronic
939011476 2:136851833-136851855 TGGAAATATCCTGCCATTGTGGG + Intronic
939169663 2:138679987-138680009 TGGGTAAATTCAGCCACTGGAGG - Intronic
942294709 2:174506411-174506433 TCTGTAATCCCAGCCATTGTGGG - Intergenic
1171040051 20:21754661-21754683 TGTGTGAATCCAGCTATGGTGGG - Intergenic
1173380515 20:42535592-42535614 TGGCTAAATAGAGCTATTGTGGG + Intronic
1173548761 20:43917436-43917458 TGGCTGAATCCAGACATTGTGGG + Intronic
1174613725 20:51820012-51820034 GGGGAAAATCAAGCGATTGTTGG + Intergenic
1175319776 20:58077243-58077265 TGAGTAAATCAAGCTGTTGTAGG + Intergenic
1176070262 20:63222579-63222601 CAGGTAGATCCAGCCATTGTGGG - Intergenic
1180257144 21:46638257-46638279 TGGTTCAATCCTGCCACTGTAGG + Intronic
1180760460 22:18198541-18198563 TGGGTAATTCCAGGCATAGAGGG + Intergenic
1180770773 22:18382838-18382860 TGGGTAATTCCAGGCATAGAGGG + Intergenic
1180775209 22:18426155-18426177 TGGGTAATTCCAGGCATAGAGGG - Intergenic
1180808283 22:18737210-18737232 TGGGTAATTCCAGGCATAGAGGG - Intergenic
1180828717 22:18885797-18885819 TGGGTAATTCCAGGCATAGAGGG + Intergenic
1181071206 22:20342175-20342197 TGGGTAATTCCAGGCATAGAGGG - Intergenic
1181194280 22:21171124-21171146 TGGGTAATTCCAGGCATAGAGGG - Intergenic
1181215163 22:21321654-21321676 TGGGTAATTCCAGGCATAGAGGG + Intergenic
1181525387 22:23481920-23481942 TGGGTAATTCCAGGCATAGAGGG + Intergenic
1182153526 22:28048120-28048142 TGGGTAAATCCATGCATAATGGG + Intronic
1182460909 22:30483444-30483466 TGGGTAACCCCAGGCATTGTGGG - Intergenic
1203232608 22_KI270731v1_random:124010-124032 TGGGTAATTCCAGGCATAGAGGG + Intergenic
1203278808 22_KI270734v1_random:111785-111807 TGGGTAATTCCAGGCATAGAGGG + Intergenic
954868648 3:53750488-53750510 TGGGTACAGCCAGCTATGGTTGG - Intronic
957335689 3:78825617-78825639 TGGGTACATGCACCCATAGTAGG + Intronic
960451964 3:117820993-117821015 TGGGTAATTAAAGCCACTGTGGG + Intergenic
961666790 3:128497738-128497760 TGGAAAAATACAGCCTTTGTCGG - Intergenic
972925389 4:43999458-43999480 TGGGCAAATCTAATCATTGTGGG - Intergenic
975723304 4:77268900-77268922 TGGATAAAGCCAGACATTATGGG + Intronic
984691827 4:182734711-182734733 AAGGTAAATCCAGCCAAAGTGGG - Intronic
984937233 4:184899832-184899854 TGTGGCAATCCAGCCATTATGGG - Intergenic
987723007 5:21663081-21663103 TGGGTAGATACAGCCATTGCAGG + Intergenic
990878439 5:60513815-60513837 TAGCTAAATCCAGCCTTTGAGGG + Intronic
1004605733 6:17193590-17193612 TGGGCACATCAAGCTATTGTGGG - Intergenic
1006893051 6:37446322-37446344 TGGGTAAATACAGCCAGGGTCGG + Exonic
1016450338 6:144175929-144175951 AGGGTAAATCCAGCTAATGCTGG - Intronic
1017323619 6:153121225-153121247 TTGGTAAATACAGCCTGTGTGGG - Intronic
1018370077 6:163159971-163159993 TGGGGAAAGCCAGCCTCTGTCGG - Intronic
1027261082 7:76465129-76465151 TGGGCACATCCAGGCATCGTGGG + Intronic
1030528464 7:110681823-110681845 TGAGTAATTCAAGCCATTGAAGG + Intronic
1032274431 7:130441531-130441553 TGGGTAAATACAGTAATTATCGG + Intronic
1033607767 7:142939918-142939940 GGGGTAACTCCAGCCACTGATGG + Intronic
1035052192 7:156005339-156005361 TTGGCACATGCAGCCATTGTGGG - Intergenic
1047666145 8:127093383-127093405 TGTGTAAGTATAGCCATTGTTGG + Intergenic
1050041953 9:1504949-1504971 TGTCTAAATCCAGCCTATGTTGG + Intergenic
1053022717 9:34707083-34707105 TGTGTACATCCAGCCAGAGTGGG + Intergenic
1053529994 9:38870965-38870987 TGGGTAAATCCATGAAATGTGGG + Intergenic
1054202219 9:62095392-62095414 TGGGTAAATCCATGAAATGTGGG + Intergenic
1054636138 9:67492968-67492990 TGGGTAAATCCATGAAATGTGGG - Intergenic
1188096600 X:26031325-26031347 TGGATAAGTTCAACCATTGTGGG + Intergenic
1190703306 X:53004352-53004374 TGTGTAAATCCAGGCTTTGGTGG - Intergenic
1192169575 X:68845929-68845951 CAGGAAAATCCAGCCATTGTGGG - Intergenic
1193283839 X:79688406-79688428 TGTGTAAATCCAGTCTTGGTGGG + Intergenic
1197223288 X:123933259-123933281 TGGGTAAATACACCCATTCCAGG - Intergenic