ID: 927258374

View in Genome Browser
Species Human (GRCh38)
Location 2:21060807-21060829
Sequence TATGGTTCAAACTAATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927258374_927258376 1 Left 927258374 2:21060807-21060829 CCTGTCTATTAGTTTGAACCATA No data
Right 927258376 2:21060831-21060853 ATGACATTGCCATTTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927258374 Original CRISPR TATGGTTCAAACTAATAGAC AGG (reversed) Intergenic
No off target data available for this crispr