ID: 927258485

View in Genome Browser
Species Human (GRCh38)
Location 2:21061806-21061828
Sequence TGTATCACTCTCCAACTCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927258485_927258491 5 Left 927258485 2:21061806-21061828 CCTACGAGTTGGAGAGTGATACA No data
Right 927258491 2:21061834-21061856 CCAGTGAGATGTGAGGGAAGAGG No data
927258485_927258492 6 Left 927258485 2:21061806-21061828 CCTACGAGTTGGAGAGTGATACA No data
Right 927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG No data
927258485_927258487 -1 Left 927258485 2:21061806-21061828 CCTACGAGTTGGAGAGTGATACA No data
Right 927258487 2:21061828-21061850 ATCCCTCCAGTGAGATGTGAGGG No data
927258485_927258486 -2 Left 927258485 2:21061806-21061828 CCTACGAGTTGGAGAGTGATACA No data
Right 927258486 2:21061827-21061849 CATCCCTCCAGTGAGATGTGAGG No data
927258485_927258493 7 Left 927258485 2:21061806-21061828 CCTACGAGTTGGAGAGTGATACA No data
Right 927258493 2:21061836-21061858 AGTGAGATGTGAGGGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927258485 Original CRISPR TGTATCACTCTCCAACTCGT AGG (reversed) Intergenic
No off target data available for this crispr