ID: 927258492

View in Genome Browser
Species Human (GRCh38)
Location 2:21061835-21061857
Sequence CAGTGAGATGTGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927258485_927258492 6 Left 927258485 2:21061806-21061828 CCTACGAGTTGGAGAGTGATACA No data
Right 927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927258492 Original CRISPR CAGTGAGATGTGAGGGAAGA GGG Intergenic
No off target data available for this crispr