ID: 927261698

View in Genome Browser
Species Human (GRCh38)
Location 2:21098145-21098167
Sequence CTAAAGAAACAGATTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927261698_927261705 30 Left 927261698 2:21098145-21098167 CCCTGAGCAATCTGTTTCTTTAG No data
Right 927261705 2:21098198-21098220 AAGCTCACCAGGGTGCCTATGGG No data
927261698_927261703 20 Left 927261698 2:21098145-21098167 CCCTGAGCAATCTGTTTCTTTAG No data
Right 927261703 2:21098188-21098210 GGAATGACAAAAGCTCACCAGGG No data
927261698_927261701 -1 Left 927261698 2:21098145-21098167 CCCTGAGCAATCTGTTTCTTTAG No data
Right 927261701 2:21098167-21098189 GCATCTTACATAAACATGGCTGG No data
927261698_927261704 29 Left 927261698 2:21098145-21098167 CCCTGAGCAATCTGTTTCTTTAG No data
Right 927261704 2:21098197-21098219 AAAGCTCACCAGGGTGCCTATGG No data
927261698_927261700 -5 Left 927261698 2:21098145-21098167 CCCTGAGCAATCTGTTTCTTTAG No data
Right 927261700 2:21098163-21098185 TTTAGCATCTTACATAAACATGG No data
927261698_927261702 19 Left 927261698 2:21098145-21098167 CCCTGAGCAATCTGTTTCTTTAG No data
Right 927261702 2:21098187-21098209 TGGAATGACAAAAGCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927261698 Original CRISPR CTAAAGAAACAGATTGCTCA GGG (reversed) Intergenic
No off target data available for this crispr