ID: 927264605

View in Genome Browser
Species Human (GRCh38)
Location 2:21130855-21130877
Sequence TCATTTTTACTGCTAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927264605_927264607 29 Left 927264605 2:21130855-21130877 CCTTGATCTAGCAGTAAAAATGA 0: 1
1: 0
2: 7
3: 53
4: 295
Right 927264607 2:21130907-21130929 TGTCTTTTTAATATTCCATGTGG 0: 1
1: 0
2: 6
3: 43
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927264605 Original CRISPR TCATTTTTACTGCTAGATCA AGG (reversed) Intronic
902492611 1:16795814-16795836 TCAATTTTTCTTCTAGGTCATGG + Intronic
904191698 1:28749608-28749630 TCATTTTTACTTGTAGTTAAAGG - Intronic
904321580 1:29701124-29701146 TCATTTTAACTACCAGGTCATGG + Intergenic
905448667 1:38043793-38043815 TCCTTTTTACTGCTAGGGCTGGG - Intergenic
905522355 1:38609972-38609994 TTATTTTTACTGATACATAATGG + Intergenic
905826639 1:41030596-41030618 GCATTTTTACTAGGAGATCAGGG - Intronic
905833423 1:41094177-41094199 TAAATTTTACTGCTTCATCAAGG + Intronic
906552564 1:46677666-46677688 TCATTTTTAGTACTATTTCAGGG - Exonic
906560831 1:46755637-46755659 TCATGTCTCCTGCTAAATCATGG - Intergenic
906914231 1:49991646-49991668 CCATTATTACTGCAAGTTCAAGG + Intronic
906973051 1:50538362-50538384 TAATTTTTACTGCTTCATCAAGG + Intronic
907510906 1:54958036-54958058 TCTTTTGTACTGCTATCTCATGG + Intergenic
907663006 1:56410872-56410894 TCATTTTTATTGCTTCGTCAAGG + Intergenic
908692134 1:66794413-66794435 TAATTTTTACTGCTTAATCAAGG + Intergenic
909604160 1:77492238-77492260 TCTTTTTTACTGCTTCATCAAGG + Intronic
910042373 1:82868159-82868181 TAATTTTTACTGCTGCTTCAGGG + Intergenic
910333155 1:86098620-86098642 TCATATTTACTTCTAAAGCATGG - Intronic
910618191 1:89223500-89223522 TCATTTTCACTGCTTGATGTAGG - Intergenic
910779117 1:90908337-90908359 TGATTTTTTCTGCTTGTTCATGG - Intergenic
912260638 1:108108720-108108742 TCATTTTTAGTGATAGACAAAGG - Intergenic
913175592 1:116270236-116270258 TTATTTTAACAGCTAGATCTAGG - Intergenic
916160067 1:161902339-161902361 TAATTTTTACTGCTTCAACAAGG + Intronic
916546003 1:165805062-165805084 TCATTTCTTTTGCTAGAACATGG + Intronic
917173640 1:172206485-172206507 TAATTTTTACTGTTGTATCAAGG + Intronic
917239761 1:172934968-172934990 TCATTTGTCCTGCTCTATCATGG + Intergenic
919284456 1:195537229-195537251 TCATTTTTATTGCTTCATTATGG + Intergenic
921232927 1:213091907-213091929 TAATTTTTACTGCTTTATCAAGG + Intronic
921297982 1:213722597-213722619 ACATTGTTCCTGCTAGATGATGG + Intergenic
921474352 1:215588327-215588349 AAATTTTTACTGCTTCATCAAGG + Intronic
921489654 1:215759340-215759362 TCTCTTTTATTGCTAGTTCAAGG + Intronic
921744725 1:218726785-218726807 TAATTTTTACTGCTTCATCAAGG + Intergenic
923527835 1:234786718-234786740 TCAATTTTTCTTCTAGGTCATGG - Intergenic
923822096 1:237456106-237456128 TTATTATTATTGGTAGATCAAGG - Intronic
924509116 1:244713753-244713775 TCATTTTCACTGCTACATAGTGG + Intergenic
1063254576 10:4312102-4312124 TCATTTTTACTGCTTCATCAGGG - Intergenic
1063536185 10:6886046-6886068 TCATTATTACTACTAAACCAAGG + Intergenic
1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG + Intergenic
1064407997 10:15081366-15081388 TCTTATTTCCTGCTAAATCATGG - Intronic
1065293955 10:24257454-24257476 TCTTTTTTACTTTTAGATCCTGG + Intronic
1065492363 10:26294608-26294630 CCATTTTTTCCTCTAGATCAGGG - Intronic
1065681795 10:28242892-28242914 TAATTTTTACTGCTTCATTAAGG - Intronic
1066031698 10:31433697-31433719 TAATTTTTACTACTTCATCAAGG + Intronic
1068771163 10:60823116-60823138 ACATTTTTACTGCTTCCTCAGGG + Intergenic
1069409431 10:68138045-68138067 TGATTTTTACTGCTTCATCAAGG + Intronic
1069484413 10:68812398-68812420 ACCTTTTTACTGCCAGATCAGGG + Intergenic
1069713508 10:70506175-70506197 TCATTTTTACTGCCTCATCATGG + Intronic
1070222232 10:74459800-74459822 ACATTTTTACTGCTAAAATAAGG + Intronic
1071994317 10:91132107-91132129 TTATTTGTACTGCTTAATCAAGG - Intergenic
1072078789 10:92007177-92007199 TCATTTTTACTGCTCTATCAAGG + Intronic
1072991411 10:100198378-100198400 ATATTTTTACTGCTTTATCAAGG + Intronic
1074324589 10:112436777-112436799 CAATTTTTACTGCTTCATCAAGG - Intronic
1074427211 10:113362065-113362087 TCATTTCTATTGCTAAATAATGG + Intergenic
1074538208 10:114344042-114344064 TCATTTATAAGGCTAGATTATGG - Intronic
1075428164 10:122358090-122358112 ACTTTGTTACTGCTAGATAAGGG - Intergenic
1077312314 11:1894662-1894684 TCATTTTTATTGCCACAGCATGG + Intergenic
1078385075 11:10883587-10883609 TAATTTTTACTGCTTCACCAGGG + Intergenic
1078861131 11:15248214-15248236 TAATTTTTACTGCTTCATCAAGG + Intergenic
1079525508 11:21382873-21382895 TCATTTTTAATCCTATATCCTGG + Intronic
1079770971 11:24459354-24459376 TCAATTTTATTTCTAGATAAGGG - Intergenic
1080068829 11:28053946-28053968 TCATTTATACTGCTTGATGGGGG + Intronic
1080358724 11:31487288-31487310 TCAGTTATCCTGCTAGATCTTGG + Intronic
1081512140 11:43786333-43786355 TGATTTTCACTGCTTCATCAAGG + Intronic
1085377003 11:76073119-76073141 TAATTTTTACTGCTTCATTAAGG - Intronic
1085737109 11:79048668-79048690 TCAGTCTTCCTGCTAGGTCAGGG - Intronic
1085999763 11:81968374-81968396 TAAGTTTTACTGCAGGATCAAGG - Intergenic
1087223338 11:95569970-95569992 TCATTTTCACTGCTAGCACAGGG + Intergenic
1087243110 11:95802562-95802584 TGATTTTTATTGCTTCATCAAGG + Intronic
1087477810 11:98659518-98659540 TCATTTTTTTTTCTAGTTCAAGG - Intergenic
1087938260 11:104061137-104061159 TCCTTTTTACAGCTAAATAATGG + Intronic
1087983945 11:104653787-104653809 TCAATTTTATTGCTTTATCAAGG - Intergenic
1088384514 11:109238643-109238665 TTATTTCTACTGCAAGATGATGG + Intergenic
1088549228 11:110994058-110994080 TAATTTTTACTGCTTCATCAAGG + Intergenic
1088844847 11:113656553-113656575 TAATCTTTACTGCTTCATCAAGG + Intergenic
1089031614 11:115336127-115336149 TAATTTTTACTGCTTCATCAGGG + Intronic
1089117338 11:116106466-116106488 ATATTTTTACTGCCACATCAGGG + Intergenic
1089772136 11:120810785-120810807 TCATTATTACTTCAAGATTATGG - Intronic
1090687717 11:129142068-129142090 TCTTTTTTACTACTATAACATGG - Intronic
1091353930 11:134921105-134921127 TAAGTTTTACTGCTTCATCAAGG + Intergenic
1092575415 12:9777186-9777208 TCCTTTTTACTGCACTATCACGG - Intergenic
1092899323 12:13044148-13044170 TCATTTTCACTGCAAGCTTACGG + Intergenic
1094178800 12:27569062-27569084 GCATTCTCACTGCTAGTTCATGG + Intronic
1094256636 12:28437132-28437154 ACACTTTTACTGATAAATCATGG - Intronic
1094684013 12:32692908-32692930 TCACTTATACTGCTATATAATGG + Intronic
1095346233 12:41152046-41152068 TCATCTTTCGTGCTACATCATGG + Intergenic
1095348971 12:41187758-41187780 CCATCTTTGCTGCTAGGTCAAGG + Intergenic
1095392108 12:41720060-41720082 TCATTTTTATTGGTAAATAATGG + Intergenic
1095642981 12:44506134-44506156 TCAATTATACTGCAATATCATGG - Intergenic
1097476710 12:60066476-60066498 TTATTATTACTCCTAGAACAGGG - Intergenic
1098933505 12:76449606-76449628 TAATTTTTACTTCTTCATCAAGG - Intronic
1101165885 12:102032388-102032410 CCCTTTTTACTGGCAGATCATGG - Intronic
1101235807 12:102788290-102788312 TAATTTTTACCGCTTCATCAAGG - Intergenic
1102707024 12:114890708-114890730 GCATCTGTACTGCTAGATTATGG - Intergenic
1104173986 12:126311247-126311269 TCATCTTTACAGTTAGATCTTGG - Intergenic
1105047216 12:133014942-133014964 TCATTCTTTCTTCTAGATTATGG - Exonic
1106601726 13:31193794-31193816 TAATTTTTACTGCTTCATCAAGG + Intergenic
1107106674 13:36650561-36650583 TCATTTATATTGCTTCATCAAGG - Intergenic
1107779652 13:43884946-43884968 TCATTTTGACTGCTTGATCTTGG - Intronic
1108060110 13:46524385-46524407 TCAATTTTACTGCCTGATCTTGG + Intergenic
1108856367 13:54798753-54798775 TCTTTTTTTCTGCTAGATGAAGG - Intergenic
1112718504 13:102214670-102214692 TAATTTATATTTCTAGATCAGGG + Intronic
1112921647 13:104621003-104621025 TTGTTTTGACTGCCAGATCATGG + Intergenic
1113207121 13:107929907-107929929 TCTTCTTGAATGCTAGATCAGGG - Intergenic
1113818399 13:113192272-113192294 TCATATTTACTGCATTATCAAGG - Intronic
1114435794 14:22707024-22707046 TCATTGTTAAAGCTAGATGATGG + Intergenic
1114620202 14:24091574-24091596 TAATTTTTAATGGTAAATCAAGG + Intronic
1118795062 14:69135349-69135371 TTATTTTTACTGCTTCATCAAGG - Intronic
1120185817 14:81392820-81392842 TAATTTTTACTGCCTCATCAAGG + Intronic
1120781192 14:88487181-88487203 TCAGTTTTACTGCAAGATCTAGG + Intronic
1121966251 14:98308549-98308571 ATATTTTTACTGCTTCATCAAGG - Intergenic
1122127230 14:99585994-99586016 TCATTGTTACTGCTTGGTCTGGG - Intronic
1124022905 15:25940027-25940049 TGATATTTACTCCAAGATCATGG + Intergenic
1124682991 15:31753027-31753049 TCATTTTTACTGTTTCATCAGGG + Intronic
1125014713 15:34921021-34921043 TTTTTTTTACTGCTTCATCAAGG - Intronic
1125018250 15:34958741-34958763 TCATTTTTTCTTCTATATTAAGG - Intronic
1125780929 15:42266710-42266732 TAATTTTTACTGCTTTATCTAGG - Intronic
1128991682 15:72265990-72266012 CCATTTTTGCTGCTATCTCAGGG - Exonic
1129529785 15:76255945-76255967 TAATTCTTACTGCTTTATCAAGG - Intronic
1130007773 15:80117746-80117768 TAATTTTTACTGTGAGAGCATGG + Intronic
1130578298 15:85113025-85113047 ACATTTTTACTCCTAGAGAATGG + Intronic
1130810586 15:87373771-87373793 TCATTTCTTCTGCTAGTTCTGGG - Intergenic
1130976037 15:88775826-88775848 TAATTCTTACTGCTTCATCAAGG - Intergenic
1135786678 16:25356023-25356045 TAATTTGTACTGCTACCTCAAGG - Intergenic
1135978034 16:27124026-27124048 TCATGTTTACTCCTGGACCAGGG - Intergenic
1136162139 16:28427041-28427063 TCATTTTTACTGCTTCAACAAGG - Intergenic
1136200826 16:28687949-28687971 TCATTTTTACTGCTTCAACAAGG + Intergenic
1136217168 16:28802137-28802159 TCATTTTTACTGCTTCAACAAGG + Intergenic
1136925285 16:34366592-34366614 TAATTTTTACTGTTTCATCAAGG - Intergenic
1136979289 16:35045214-35045236 TAATTTTTACTGTTTCATCAAGG + Intergenic
1138001593 16:53286576-53286598 TCATTTTAACAGCTATATCATGG + Intronic
1140287879 16:73621780-73621802 TCATTTTTAATGGAAGATCTGGG - Intergenic
1140538065 16:75729321-75729343 TCATTTTTACTCACAGATTAAGG + Intronic
1141466257 16:84207622-84207644 TTATCTTTCCTGCTAGATCATGG - Intergenic
1143534961 17:7532620-7532642 TCTTGTTTCCTGCTAAATCATGG - Intergenic
1144297625 17:13892173-13892195 CCATTTTTACAGCTAGATTGTGG - Intergenic
1146909450 17:36639166-36639188 TTATTTTTAAAGCTAGATCAGGG - Intergenic
1151275434 17:73030559-73030581 CCATTTCTCCTGCTGGATCACGG - Intronic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1156845473 18:41661019-41661041 TGAATTTTACTCCTAGATGATGG + Intergenic
1158260760 18:55603632-55603654 TCATTTTTACTATTAGTTTATGG - Intronic
1158569764 18:58588194-58588216 CCATTTTTACTGATGCATCAAGG + Intronic
1159082842 18:63754788-63754810 TCAAATTTATTTCTAGATCACGG + Intronic
1159529706 18:69639919-69639941 TGATTGTTACAGCTGGATCAGGG + Intronic
1159804893 18:72944080-72944102 TAATTTTGGCTGCTACATCATGG - Intergenic
1160478966 18:79220805-79220827 TCTTTCTTACTGCTGCATCATGG - Intronic
1160934540 19:1587418-1587440 TCATTTTTACTTTTAGATCCAGG + Intronic
1161742445 19:6031355-6031377 TAATTTTTACTGCTTCATCAAGG + Intronic
1164957278 19:32397479-32397501 TCTTGTTTCCTGCTAAATCATGG + Intergenic
1166389957 19:42403329-42403351 CTATTTTTTCTTCTAGATCAAGG + Intronic
1166587491 19:43962774-43962796 TCATTTTTCCTTCTACTTCAGGG - Exonic
1166603161 19:44115809-44115831 TCATTTTTCCTCCTATTTCAGGG - Exonic
925866990 2:8236792-8236814 TCAGTTTTTCTCCTAGATCCAGG - Intergenic
926385408 2:12331017-12331039 TGATTTTGACTGCTGGATAAAGG + Intergenic
926505326 2:13707332-13707354 TAATTTTTACTGCTGTGTCAGGG - Intergenic
926895065 2:17677786-17677808 TAATTTCTACTGGTAGATCATGG - Intronic
927264605 2:21130855-21130877 TCATTTTTACTGCTAGATCAAGG - Intronic
928283532 2:29969445-29969467 TCTTGTTTACTGCTTCATCAGGG - Intergenic
928400600 2:30975715-30975737 TCAATGTTACTGCTGGATAATGG + Intronic
928472024 2:31584218-31584240 TCATTTCTACTACTAAACCATGG - Intergenic
928558494 2:32451520-32451542 TAATTTTTACTGCAACGTCAAGG - Intronic
930450598 2:51531921-51531943 TCATTTCTTCTGCTAGATTCAGG + Intergenic
931310739 2:61077634-61077656 TAATTTTTACTGCTTTACCAAGG - Intronic
933745323 2:85566606-85566628 TAATTTGTACTGCTTCATCAGGG + Intronic
935875723 2:107504757-107504779 TCTTTTCTCCTGCTAAATCATGG - Intergenic
936407375 2:112218232-112218254 TAATTGTTACTGCTTCATCAAGG + Intronic
938881670 2:135595872-135595894 TCATTTTGTTTGCTAGAACAGGG + Intronic
939063583 2:137454780-137454802 TCAATTTTACTGCTAGCTTTAGG + Intronic
939373887 2:141338835-141338857 TAATGTTACCTGCTAGATCAAGG - Intronic
939465895 2:142556199-142556221 TTATTTTTACTTCTGAATCATGG + Intergenic
940377678 2:152974070-152974092 TAGTTTTTACTGCTTTATCAGGG - Intergenic
941823541 2:169866681-169866703 TCATTTTTTCTTTTAAATCAAGG + Intronic
943292907 2:186098162-186098184 TGATTTTTTCTGATAGATCTGGG + Intergenic
944001678 2:194846592-194846614 TCATTTTCACTGCTTCATCAAGG + Intergenic
944609301 2:201384777-201384799 TAATTTTTACTGCTACTTCAAGG - Intronic
945074829 2:206027917-206027939 TTAATTTTACTGTTAGCTCATGG + Intronic
945248157 2:207739733-207739755 TAATTTTTACTGCTTCAGCAAGG + Intronic
945452739 2:210012423-210012445 TAATTTCTACTGCTTCATCAAGG - Intronic
945500160 2:210562823-210562845 TCATTTTTACTACTAGCTCAAGG + Intronic
946839376 2:223804926-223804948 TCATTTTTATTGTTAGTTTAAGG - Intronic
947230642 2:227882485-227882507 TAATTTTTACTGCTTCATCAAGG - Intronic
947272655 2:228354403-228354425 TAATTTTTAGTGCTTTATCAGGG + Intergenic
947379732 2:229533501-229533523 TAATTTTTACTGCCGCATCAAGG - Intronic
948019785 2:234721008-234721030 TCACTTTTACTGAAACATCAAGG - Intergenic
1168779042 20:473237-473259 ACATTTTTACTTCTAACTCAAGG + Intergenic
1169180209 20:3558636-3558658 TGATATTTATTTCTAGATCATGG + Intronic
1169526761 20:6436730-6436752 GCATTTTTACAGCAATATCATGG - Intergenic
1172382911 20:34511881-34511903 TCTTGTTTCCTGCTAAATCATGG + Intergenic
1173164234 20:40675132-40675154 TCATTTTGATAGGTAGATCAGGG - Intergenic
1173299803 20:41792110-41792132 TCCAATTTACTGCTAGACCAGGG + Intergenic
1174261716 20:49300799-49300821 CAATTTTTACTGCTTTATCAAGG + Intergenic
1174523098 20:51148097-51148119 TTATTTTTTCTGGTACATCAGGG + Intergenic
1175147460 20:56907690-56907712 TCATTTTGACTGGTGGATCAGGG - Intergenic
1175294377 20:57898253-57898275 TCATTTTACCTGCCAGAGCACGG + Intergenic
1176452025 21:6871876-6871898 TCATTTTTATTTCTATATTATGG - Intergenic
1176830197 21:13736925-13736947 TCATTTTTATTTCTATATTATGG - Intergenic
1177571800 21:22896480-22896502 TCATTTTAATTACTAGCTCATGG - Intergenic
1177723209 21:24934341-24934363 TTATTTTTTCTGCAAGATTATGG - Intergenic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1180236780 21:46465727-46465749 TAATTTTTACTGCTTCATCAGGG - Intronic
1183127408 22:35797503-35797525 TACTTTTTACTGCTTCATCAAGG + Intronic
1183682022 22:39337162-39337184 TAATTTTTATTGTTATATCAAGG + Intergenic
1184699101 22:46157630-46157652 TCTTTCTTTCTGCAAGATCATGG + Intronic
949659743 3:6264817-6264839 GCATTTTGACTGCGAGGTCAGGG - Intergenic
949848877 3:8400917-8400939 TTATTTTCATTGCTATATCATGG + Intergenic
951554556 3:23907729-23907751 TCATTTTTATTGCTTCATTAAGG - Intronic
951603519 3:24403680-24403702 TAATTTTTACTGTTTAATCAAGG - Intronic
953263312 3:41361070-41361092 TCACTTTTCCTGCTTGCTCAAGG - Intronic
954838064 3:53488166-53488188 TTATTTTTACTGCTTCATCAAGG - Intergenic
956072811 3:65472481-65472503 TCATTTTTTCTTTTAGTTCATGG - Intronic
957090458 3:75724624-75724646 TATTTTTTACTGCTTCATCAAGG + Intronic
958532938 3:95357446-95357468 GCCTTATTACTGCTAGATGAGGG - Intergenic
959662090 3:108880055-108880077 TCCTTGTTACTGCTAGATTGGGG - Intergenic
960410821 3:117322257-117322279 TCATGTTTTCTGCTACAACATGG + Intergenic
962150782 3:132891231-132891253 TCATTTTTAGTGCTTAATCAAGG + Intergenic
962711546 3:138090779-138090801 TCATTGGTCCTCCTAGATCAAGG - Intronic
964198863 3:154094931-154094953 TCACTTTTATTACTTGATCAAGG - Intergenic
964873796 3:161342696-161342718 TCATTTATACTGTAAGATGATGG - Intergenic
965200663 3:165653960-165653982 TCTTTTTTACTGCAATACCATGG + Intergenic
966176770 3:177147012-177147034 TACTTTTTACTGCTTCATCAAGG + Intronic
966517236 3:180831148-180831170 TCATTTTTATTGCTTTATAAAGG - Intronic
966543005 3:181112949-181112971 CAATTTTTACTGTTAGATGATGG + Intergenic
969073148 4:4556042-4556064 CCATTTCTTATGCTAGATCAAGG - Intergenic
969541461 4:7792795-7792817 TCATTTTTACTGCTTCCTCAAGG + Intronic
970969155 4:21961263-21961285 TCATTTACACAGCTAAATCAGGG + Intergenic
972840995 4:42929782-42929804 TTATTATTATTGCTATATCAAGG - Intronic
972936069 4:44137689-44137711 TCTCTTTTACTGGTACATCATGG - Intergenic
973081970 4:46003901-46003923 GCATTTTTAGTTCTAGTTCAAGG - Intergenic
975111411 4:70631867-70631889 TCACTTTTACTGCTAAATCCAGG - Exonic
975742609 4:77443957-77443979 TTAATTTTACTGCAAGGTCATGG - Intergenic
975742613 4:77444002-77444024 TAATTTTAACTGCTCCATCATGG - Intergenic
976697167 4:87929322-87929344 TTATTTTGGCTGCTAAATCATGG - Intergenic
977706148 4:100072496-100072518 TGATTTTTACTACTTCATCAAGG - Intergenic
977923894 4:102676952-102676974 TAATGTTTACTGCTTTATCAAGG - Intronic
978228575 4:106368628-106368650 TTCTTTTTACTCCTAAATCAGGG + Intergenic
978511029 4:109518265-109518287 TCATTTTTAAAGCTAGATGAGGG - Intronic
978735853 4:112083398-112083420 TCATTTTTCCTCCAGGATCATGG - Intergenic
980956678 4:139435895-139435917 TCCTTTCTACTGCTAGCTCTGGG + Intergenic
981551129 4:145942167-145942189 TAATTTTTACTGCTCTATCAAGG - Intergenic
981796637 4:148603202-148603224 ACATTTTTTCTGTTAGTTCAGGG + Intergenic
982758672 4:159254127-159254149 TAATTATTACTGCTTTATCAAGG + Intronic
982898271 4:160962492-160962514 ACATTCTTTCTGTTAGATCATGG + Intergenic
983870697 4:172822114-172822136 TCATTTTCACTGTTAAATGAAGG - Intronic
984505825 4:180617190-180617212 TTATTTTTATTGATACATCATGG - Intergenic
984602167 4:181740760-181740782 TCATTTTTGTTACTAGTTCATGG - Intergenic
984674940 4:182536334-182536356 TCAGTCCTACTGCTAGAACATGG - Intronic
985134366 4:186770450-186770472 TCATTGTTACAGCTTCATCAAGG - Intergenic
986804308 5:11294219-11294241 TCATTTTTACTGCGACATCAAGG - Intronic
986981777 5:13456391-13456413 TTATTATTACTACTAGATAATGG + Intergenic
987390538 5:17371046-17371068 TCATTTTTGCTGCTTTATAAAGG + Intergenic
988966430 5:36423117-36423139 TCATTATCACTGCTAGATGTTGG + Intergenic
990119498 5:52432744-52432766 TAATTTTTACTCCTTTATCAAGG + Intergenic
990758179 5:59099285-59099307 GGATCTTTACTGATAGATCAAGG - Intronic
990802414 5:59619790-59619812 ACATTTTTAGTGCTAAATCCAGG - Intronic
991274802 5:64832658-64832680 TTTTTTTTACTGCTTCATCAAGG + Intronic
994330916 5:98505338-98505360 TCATTTTTACAGCTACTTGAAGG - Intergenic
996292324 5:121866665-121866687 TCATTTTAGCTCCTAGAGCACGG + Intergenic
998234651 5:140388060-140388082 TAATTTTTACTGCTTCATCAAGG + Intergenic
998864327 5:146480671-146480693 TCCTTTTTGCTGCTAAATAATGG - Intronic
998990436 5:147809594-147809616 TTAGTTTAACTGATAGATCATGG - Intergenic
999436558 5:151567887-151567909 TTATTTTTATTCCCAGATCAGGG - Exonic
999677963 5:154025246-154025268 TAATTTTTACTGCTTCATCAAGG + Intronic
999786996 5:154899734-154899756 TAATTTTTACTGCTTCATTAAGG - Intronic
1000253665 5:159518321-159518343 TCATTTTTCTTGCTAGATGGAGG - Intergenic
1002678164 5:180935869-180935891 ACACTTTTCCTGCTAGATCAGGG + Intronic
1003847944 6:10193236-10193258 TCATTTTTACTGCCGCATCAGGG - Intronic
1004318014 6:14608475-14608497 TCAGTTGTACTGCTTTATCAAGG + Intergenic
1004762424 6:18682891-18682913 TCATTTCTAATGTTAGTTCAAGG - Intergenic
1005921303 6:30404342-30404364 TCTTTTTTCCTGCTGGATCAGGG + Intergenic
1006065646 6:31460503-31460525 TCTTTTTCCCTGCTGGATCAGGG + Intergenic
1006805157 6:36783358-36783380 TTACTTTTACTGCAAGTTCAGGG - Intronic
1007416115 6:41692249-41692271 TCTTTTTCACTGCTATACCATGG + Intronic
1007961043 6:45959882-45959904 TAATTTTTAATGCTTCATCAAGG + Intronic
1008168599 6:48172641-48172663 TAATTTTTAGTGCTTCATCAAGG - Intergenic
1008336086 6:50306408-50306430 TCTTTTTTCCTGCTAAATCATGG - Intergenic
1008374856 6:50779925-50779947 TGATTTTTACTGGTAAATCCTGG - Intergenic
1009775385 6:68198920-68198942 TCTTTTTTACTGCTAGCTTTGGG - Intergenic
1011155658 6:84327847-84327869 TCATTTTTAATGTTAGAGTAGGG + Intergenic
1011309521 6:85966729-85966751 TCATTTTTACTTGTACAGCAAGG + Intergenic
1011480989 6:87793361-87793383 TTATTTTTACTGCTTCATCAGGG - Intergenic
1013833641 6:114305629-114305651 AGATTTTTACTGCTTCATCAAGG + Intronic
1014692235 6:124576083-124576105 TAATTTTTAATGCTTGATTAAGG - Intronic
1015204465 6:130619013-130619035 TCTTGTTTCCTGCTAAATCAGGG - Intergenic
1015313158 6:131787110-131787132 TCATTTTTAATTCTAGATATGGG - Intergenic
1015446808 6:133315663-133315685 ACATTTTTACTTCTATTTCAAGG - Intronic
1016737690 6:147497802-147497824 TAATTTTTACTGCTCCATGAAGG + Intergenic
1016738333 6:147504922-147504944 TCATTTTTGCTGCAAGCTCTTGG - Intergenic
1016743706 6:147555103-147555125 TAATTTCTACTGCTTCATCAAGG - Intronic
1020866706 7:13573423-13573445 TCCTTTTTACAGCTGAATCAAGG + Intergenic
1020924858 7:14312501-14312523 AAATTTTTACTGCTTCATCAAGG - Intronic
1021941136 7:25679977-25679999 TCCTTTTTACTGCTGGAATAAGG + Intergenic
1022053045 7:26698532-26698554 TAATTATTACTGCTTCATCAAGG - Intronic
1022149354 7:27584753-27584775 TAATTTTTAATGCTTCATCAAGG + Intronic
1022349557 7:29554809-29554831 TCTTTCTTTCTGCTAGAACATGG + Intergenic
1023569352 7:41556227-41556249 ATATTTTTACTGCCACATCAAGG + Intergenic
1024109350 7:46129774-46129796 TCATTTTGGCTGCAAGATGAGGG + Intergenic
1026430001 7:70335824-70335846 TCATTAATACTGCTTGATGATGG - Intronic
1026924437 7:74180425-74180447 TCATTTTTACTGCTTTACCAAGG + Intronic
1026972382 7:74476260-74476282 TTATTTTTATTACTAAATCATGG + Intronic
1027175097 7:75898371-75898393 TCATTTTAACTGCTGGGTCTAGG - Intergenic
1027701318 7:81473179-81473201 CCATTTTTACTGCTGGTGCAGGG - Intergenic
1028912766 7:96226633-96226655 TTATTTTTTATACTAGATCACGG - Intronic
1030933731 7:115557989-115558011 TTATTTTTAATGCAAGAGCAGGG + Intergenic
1031098212 7:117446360-117446382 CCATTTTTACTTCAAGGTCAGGG + Intergenic
1032796415 7:135280477-135280499 TCATTTTATCTTCTAGATTATGG + Intergenic
1033003001 7:137527775-137527797 TCATTATTACTATTAAATCAGGG - Intronic
1034145048 7:148862774-148862796 TCATTTTTAGTACTTCATCAAGG + Intronic
1036624826 8:10461093-10461115 TCATTTTTAGTACTTCATCAAGG + Intergenic
1037014876 8:13891585-13891607 TCATTTTATCTTCAAGATCATGG + Intergenic
1041557998 8:59180972-59180994 TTATTTTTACTGCTTAGTCAAGG - Intergenic
1042251566 8:66761070-66761092 TAATCTTTACTGCTTTATCAAGG + Intronic
1042695705 8:71552942-71552964 TTATTTTTACTGCTACCTCTAGG - Intronic
1042972949 8:74431161-74431183 TCATTTTTATTTCTATATTATGG - Intronic
1043192091 8:77238320-77238342 TGATTTTTATTGCTTGATTATGG + Intergenic
1043248190 8:78033289-78033311 TCATTTTTACTTATAAATGATGG - Intergenic
1045038344 8:98195323-98195345 TCATGCTGACTACTAGATCAAGG + Intronic
1045394285 8:101745078-101745100 TAATTTTTACTGCTTTATCAAGG - Intronic
1046049279 8:109002174-109002196 TTATTTTAACTGCTTGAGCAAGG + Intergenic
1046543698 8:115619838-115619860 TCCTTCTTACTGCTAGAAGATGG + Exonic
1047194090 8:122705676-122705698 TCATTTATAATGAAAGATCATGG + Intergenic
1047376635 8:124304232-124304254 TAATTTTTACTGCTTTATTAAGG - Intergenic
1048557279 8:135491972-135491994 TCATTTCTATTGCTCCATCAAGG - Intronic
1050002284 9:1090486-1090508 TAATTTTTACTACTAGATCAAGG - Intergenic
1050052404 9:1616841-1616863 TCATTTTCCCTGATAGAACATGG - Intergenic
1051346703 9:16157565-16157587 TCATGTTTGCTGCTAGATAATGG + Intergenic
1052578149 9:30317783-30317805 TTAAATTTACTGCTAGATCTGGG + Intergenic
1054388487 9:64587797-64587819 TCCTTTTTACCACTAGATGATGG + Intergenic
1054896631 9:70320789-70320811 TGAATTTTACTGCTTCATCAAGG + Intronic
1055054361 9:72010464-72010486 TCAGTTTTTCTGGTACATCAAGG - Intergenic
1055134998 9:72818714-72818736 TGATTTTTACTGACAGATGATGG + Intronic
1055660533 9:78499396-78499418 TAATTTTTACTGCATCATCAAGG + Intergenic
1055891817 9:81131679-81131701 CCACTTTTACTCATAGATCAAGG - Intergenic
1056370849 9:85952840-85952862 TAATTTTTACTGCTTTATCAAGG + Intronic
1058552608 9:106131487-106131509 TCATTTCTCCTACTAGATTAAGG - Intergenic
1058867951 9:109178941-109178963 TAATTTTTACTGCTTCTTCAAGG - Intronic
1059097065 9:111429208-111429230 TCATTTTTACTGCTTCATCAAGG + Intronic
1059983813 9:119801949-119801971 TTATTTTTACAGATAGAGCAAGG + Intergenic
1060582495 9:124763212-124763234 TCATTTTTACTGCTTCATCAAGG + Intronic
1060702451 9:125769118-125769140 TAATTTTTACTGTTTCATCAAGG + Intronic
1061458449 9:130716415-130716437 TAATTTTTGCTGCTTCATCAAGG - Intronic
1062260833 9:135662557-135662579 TCTTTTCTCCTGCTAAATCATGG - Intergenic
1203517156 Un_GL000213v1:12639-12661 TCATTTTTATTTCTATATTATGG + Intergenic
1185951201 X:4436295-4436317 TCTTGTTTCCTGCTAAATCATGG - Intergenic
1187553539 X:20329374-20329396 TAATTTTTACTGTTTAATCAAGG - Intergenic
1187710192 X:22045663-22045685 TCAGTTCTACTGCTAGACCTGGG + Intronic
1189096076 X:38141169-38141191 TATTTTTTACTGCTTCATCAGGG - Intronic
1193469449 X:81881427-81881449 TCATTTTTGCTACTCCATCAAGG - Intergenic
1194337804 X:92669527-92669549 TCATTTTTATTTCTAGTTGAAGG - Intergenic
1195156472 X:102128167-102128189 TATTTTTTTCTGCTAGAGCAGGG - Intergenic
1196583193 X:117399032-117399054 TTATTTTTACTGCCAAATAATGG - Intergenic
1196775899 X:119337157-119337179 TGATTTTTACTTCTTCATCAAGG - Intergenic
1198780462 X:140229702-140229724 TCATTTTTCCTGATAGACCGGGG + Intergenic
1198890468 X:141389578-141389600 GCATTATTACTGCTATATTAAGG + Intergenic
1199369622 X:147032060-147032082 TCTTTTTAACTTCTAGATCTTGG + Intergenic
1200046121 X:153402120-153402142 TCATTGTTACTGCTAGAAAAGGG - Intergenic
1200523720 Y:4245958-4245980 TTATTTTTTCTGCTAGTTTAAGG + Intergenic
1201863058 Y:18620814-18620836 TCATTTTTACAGCTGGAGCAAGG + Intergenic
1201870265 Y:18699564-18699586 TCATTTTTACAGCTGGAGCAAGG - Intergenic