ID: 927271515

View in Genome Browser
Species Human (GRCh38)
Location 2:21215176-21215198
Sequence ACGATGGCATAGAAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927271515_927271523 5 Left 927271515 2:21215176-21215198 CCCCTCTCCTTCTATGCCATCGT No data
Right 927271523 2:21215204-21215226 ATGTTAAATGGCAGGAAGGAAGG No data
927271515_927271524 9 Left 927271515 2:21215176-21215198 CCCCTCTCCTTCTATGCCATCGT No data
Right 927271524 2:21215208-21215230 TAAATGGCAGGAAGGAAGGAAGG No data
927271515_927271520 -7 Left 927271515 2:21215176-21215198 CCCCTCTCCTTCTATGCCATCGT No data
Right 927271520 2:21215192-21215214 CCATCGTTTTGAATGTTAAATGG No data
927271515_927271525 20 Left 927271515 2:21215176-21215198 CCCCTCTCCTTCTATGCCATCGT No data
Right 927271525 2:21215219-21215241 AAGGAAGGAAGGAAATACAAAGG No data
927271515_927271522 1 Left 927271515 2:21215176-21215198 CCCCTCTCCTTCTATGCCATCGT No data
Right 927271522 2:21215200-21215222 TTGAATGTTAAATGGCAGGAAGG No data
927271515_927271521 -3 Left 927271515 2:21215176-21215198 CCCCTCTCCTTCTATGCCATCGT No data
Right 927271521 2:21215196-21215218 CGTTTTGAATGTTAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927271515 Original CRISPR ACGATGGCATAGAAGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr