ID: 927271988

View in Genome Browser
Species Human (GRCh38)
Location 2:21221179-21221201
Sequence CAGAGGCAGCACAGCTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927271983_927271988 18 Left 927271983 2:21221138-21221160 CCATTAAGGAGGTTTGGTCAGGA No data
Right 927271988 2:21221179-21221201 CAGAGGCAGCACAGCTATGTGGG 0: 1
1: 0
2: 1
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927271988 Original CRISPR CAGAGGCAGCACAGCTATGT GGG Intergenic
900369251 1:2324092-2324114 CTGCGGCAGCACACCTAGGTAGG - Exonic
903919578 1:26789833-26789855 CAGAGGCAGCTCATCAATTTGGG - Intronic
904767480 1:32861611-32861633 TAGAGGCTGCACAGCAAAGTAGG - Intergenic
908033154 1:60022876-60022898 CATATACAGCACAGATATGTTGG + Intronic
909678392 1:78263631-78263653 CAGAGGCAGCACAGCTTGCAGGG - Intergenic
909806136 1:79875835-79875857 CAGAGGCAGGATAGTTATGCTGG - Intergenic
910764114 1:90763559-90763581 CATAGGCAGAGCAGCGATGTGGG + Intergenic
915095188 1:153457574-153457596 GAGAGGCAGCTCAGCTCTGCTGG + Intergenic
915262178 1:154684927-154684949 CAGAAGCATCACAGCAATTTTGG + Intergenic
915900261 1:159841573-159841595 CAGAAGGAGCACAGCAGTGTGGG + Intronic
917635646 1:176933166-176933188 AAGAGGTAGCAGAGCTATGATGG - Intronic
918142187 1:181728656-181728678 CAGAGGACACACACCTATGTAGG - Intronic
918225052 1:182473785-182473807 CAGAGGGAGCCCTCCTATGTGGG - Exonic
919568962 1:199222039-199222061 TGGAGACAGCACAGCTGTGTGGG + Intergenic
919792798 1:201302949-201302971 CTGAGGCTGCACAGCTAGGCAGG + Intronic
919940381 1:202282082-202282104 CAGAGCCAGCCCAGCTTTGCCGG + Intronic
920347145 1:205313768-205313790 CAGAGGCTGCAGGGCTAGGTGGG + Intronic
924331761 1:242946707-242946729 CAGAGGCAGCATGGCTGTGGGGG - Intergenic
924825229 1:247531759-247531781 CAGAGACACCACAGCCACGTGGG + Exonic
1067734458 10:48838321-48838343 CAGAGGCAGGGCACTTATGTGGG + Intronic
1067742656 10:48907640-48907662 CAGAGGCACCACAGTTAGCTGGG + Intronic
1068723751 10:60277157-60277179 CAGAGCTATCACTGCTATGTCGG + Intronic
1068922987 10:62504518-62504540 CAGTGACAGGGCAGCTATGTAGG + Intronic
1069776861 10:70932392-70932414 CAAAGGCTGCACAGCTAGATGGG + Intergenic
1070712209 10:78690978-78691000 CAGTGGCACCAAAGCTATGCTGG + Intergenic
1073933042 10:108598731-108598753 CAGAGAAAGTACACCTATGTGGG - Intergenic
1075550517 10:123389402-123389424 CAGAGAAAGCACAGCTCTGCAGG - Intergenic
1076467912 10:130697686-130697708 CAGAGGGAGGACACCTCTGTGGG - Intergenic
1077974879 11:7237727-7237749 TAGAGGGAGCTCAGCTATGCTGG + Intergenic
1078453139 11:11455084-11455106 CAAAGGAAGCACAGCTATCAGGG - Intronic
1080905776 11:36543372-36543394 CAGAGGCAGTAAAGCCGTGTGGG - Intronic
1081681754 11:45011104-45011126 CTGAGGTAGCCCAGCTTTGTTGG + Intergenic
1083292313 11:61696878-61696900 CAGTGGCAGCAGAGCTGCGTGGG + Intronic
1084291344 11:68170840-68170862 CAAATGCTGCACAGCTATTTAGG - Intronic
1084889398 11:72229217-72229239 CGGAGGCTGCACAGGTATCTGGG + Exonic
1085858433 11:80203334-80203356 CACAGGCAGCACAGCAAATTGGG - Intergenic
1089304499 11:117518016-117518038 CAGAGGGAGCACAGCTTGGGTGG + Intronic
1090666287 11:128916932-128916954 AAGAGGCAGCACTGCCATGGGGG - Exonic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1094064615 12:26350002-26350024 TATAGGCAGCACAGCCATGATGG + Intronic
1094489073 12:30947320-30947342 TTGAGGCAGCAGAGCTAAGTGGG + Intronic
1095962705 12:47845312-47845334 CAGAGGGAGCACAGATGTGAAGG - Intronic
1096598875 12:52715403-52715425 CATAGGAAGCACAGCTTTCTTGG + Intergenic
1097632407 12:62080125-62080147 CAGAGGCTGCTCAGCTCTGAGGG + Intronic
1098391327 12:69972508-69972530 CAGAGGAGGCACAGTTGTGTGGG - Intergenic
1099039841 12:77638463-77638485 CAGATGCAGCACTGCTTTGCTGG - Intergenic
1103937110 12:124482618-124482640 CAAAGGCAGCACAGCTGTGGAGG + Intronic
1104430766 12:128714180-128714202 CAGAGGCAGCCTAGCTTTCTTGG - Intergenic
1105292720 13:19062790-19062812 CAGATGGAGCACAGCTGTGTAGG + Intergenic
1105715889 13:23064659-23064681 TAGAGGCAGCACAGAATTGTGGG - Intergenic
1106385569 13:29282234-29282256 CAGAGGCAGCACTTCTCTCTGGG - Intronic
1107198217 13:37681128-37681150 CAGAGTCTGCTCAGCTATGAAGG - Intronic
1109285108 13:60399347-60399369 CAGAAGCAGCACAGACAGGTGGG - Intronic
1109687473 13:65840592-65840614 CAGCGGCAGCACGTTTATGTGGG - Intergenic
1110900124 13:80811687-80811709 AAGAGGCAGCACAGCTCTCTGGG - Intergenic
1114303519 14:21399723-21399745 CAGAGTCAGCACAGAAATGCAGG + Intronic
1117312298 14:54539954-54539976 GAGAGGCAGCAGAGCTAGGATGG - Intergenic
1117567320 14:57007677-57007699 CAGAGGAGGCATTGCTATGTTGG - Intergenic
1121802018 14:96782586-96782608 CGGAGGCAGCACAGCTCTGCGGG + Intergenic
1122781140 14:104144039-104144061 CAGAGGCTGCACAGCGAGGCTGG - Intronic
1128757325 15:70191881-70191903 CAGAGGAAGCACAGCCCTGCCGG - Intergenic
1130074269 15:80675192-80675214 CATAGGCAGAACAGCTCTGAGGG - Intergenic
1131867013 15:96721943-96721965 CAGAGGCAGCACAGCAGGCTGGG - Intergenic
1133248847 16:4466781-4466803 CAGAGGCACCACAGCTGCCTAGG + Intronic
1133308451 16:4826816-4826838 CTGGGGCAGCACAGCTGTCTTGG + Intronic
1138819446 16:60241274-60241296 AAGAGGGAGCACAGCTGTATAGG - Intergenic
1138883870 16:61050782-61050804 CAGAGGCAGCACAGCTCCGGGGG + Intergenic
1138902514 16:61290683-61290705 CAGAGTCAACACTGTTATGTAGG - Intergenic
1139660092 16:68414800-68414822 CAGAGGCAGCAGGGCCAGGTAGG + Intronic
1142338962 16:89508413-89508435 CAGCAGCAGCACGGCCATGTTGG - Exonic
1142516905 17:437641-437663 CAGAGGCAGAACTGCTGTATCGG + Intergenic
1143444999 17:7002981-7003003 CAGAGGCGGCACAGCTATACTGG - Intronic
1144068063 17:11641941-11641963 CGGAGGCAGAACAGCTCTGAAGG - Intronic
1151361823 17:73593540-73593562 CAGAGGCAGAACACCTAGCTTGG + Intronic
1151677506 17:75606180-75606202 CAGAGGCTGCACGGGTATGGGGG - Intergenic
1151769001 17:76147451-76147473 CAGAGTCAGGACAGCTCTCTGGG - Intronic
1153088559 18:1318029-1318051 CCTAGGCAGCACAGCTCTGGGGG + Intergenic
1156382636 18:36578099-36578121 CAGAATCAGCATAGCTTTGTAGG + Intronic
1157291605 18:46413454-46413476 CAGAGCCTGCAGAGCTCTGTAGG - Intronic
1157568271 18:48695081-48695103 ATGAAGCAGCACAGCTATTTTGG + Intronic
1159023054 18:63158545-63158567 CAGGGCCAGCACAGCTTCGTGGG - Intronic
1159134485 18:64321237-64321259 CATAGGCAGAACAGCAATGTGGG + Intergenic
1159960530 18:74552064-74552086 CAGATCCAGCCCAGCTCTGTGGG - Intronic
1161619803 19:5292101-5292123 CAGTGGGAGCACAGCTGTGATGG - Intronic
1163260934 19:16189553-16189575 CATAGGCAGCACAGTTATAGGGG + Intronic
1164485372 19:28651260-28651282 CACAGGAAGAACAGCTCTGTAGG - Intergenic
1164511136 19:28898200-28898222 GAGAGACAGCACAGCAAAGTGGG - Intergenic
1165789587 19:38483519-38483541 CAGGGCCAGCCCAGCTATGCAGG + Intronic
1167268345 19:48494165-48494187 CTGAGGCCACACAGCTAGGTGGG - Intronic
1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG + Exonic
927095283 2:19743705-19743727 CAGAGGTAGCACACACATGTGGG + Intergenic
927271988 2:21221179-21221201 CAGAGGCAGCACAGCTATGTGGG + Intergenic
927678954 2:25127617-25127639 CAGGGTCAGCACAGCTCTGTGGG - Intronic
928174896 2:29026943-29026965 CAGAGACAGCACAGACATGTTGG + Exonic
928893990 2:36240150-36240172 CAGAGGCAGGACAGCAAGCTAGG - Intergenic
935074594 2:99728640-99728662 CAGTGCCAGAACAGCTATGAGGG + Intronic
935639007 2:105272976-105272998 CAGGTACAGCACAGCTAAGTGGG + Exonic
935883326 2:107589054-107589076 CAGTTGCAGCACACCTGTGTTGG + Intergenic
936982222 2:118275547-118275569 CAGAGGAAGCACAGCCCTGCTGG - Intergenic
937115843 2:119404453-119404475 CAGAGGCAGCACAGAGCTATGGG - Intergenic
937928052 2:127182978-127183000 CAGAGACAGCAGAGCCATTTAGG - Intergenic
938902934 2:135813693-135813715 CAGAGGCAGAATAGCAGTGTGGG - Intronic
939182826 2:138823983-138824005 CAAAAGCACCCCAGCTATGTGGG - Intergenic
940321039 2:152376728-152376750 CAGAGGCAGCCCTGCTTTTTAGG + Intronic
941740677 2:169031921-169031943 AAGAGGCAGCACAAATATATTGG - Intergenic
942798507 2:179849419-179849441 CAAAGGCAACACATCTATTTGGG + Intronic
943092289 2:183389777-183389799 CAGAGGCAGCACAGCTTGCAGGG + Intergenic
943554469 2:189385467-189385489 CAGAGGCAGCACAAATAAATGGG + Intergenic
944183268 2:196919689-196919711 CAGAGGAAACACATTTATGTTGG - Intronic
946807437 2:223485296-223485318 CAGAGGAAGCACAGTTAGTTAGG - Intergenic
947217442 2:227762116-227762138 AAGAGTCAGCACAGAAATGTTGG - Intergenic
948311370 2:236989469-236989491 CAGAGCCTGCACAGCTGAGTCGG + Intergenic
948602308 2:239114342-239114364 CCGAGGAACCACAGCTCTGTAGG - Intronic
1169275453 20:4230787-4230809 CAGAAGAAGCCCAGCTATGTGGG - Intronic
1170596475 20:17809789-17809811 CATAGCCAGGACAGCTCTGTGGG + Intergenic
1174063012 20:47845715-47845737 CAGAGGCAGCAGAGCTGAGGAGG + Intergenic
1174072712 20:47909959-47909981 CAGAGGCAGCAGAGCTAAGGAGG - Intergenic
1176297251 21:5080682-5080704 CAGAGCCAGCCCAGCTGTCTGGG - Intergenic
1176671619 21:9740099-9740121 CAGAGGCAGGATGGCTATTTTGG + Intergenic
1178284035 21:31310119-31310141 CAGGCCCATCACAGCTATGTGGG + Intronic
1178565530 21:33680814-33680836 CAGAGTCAGCACAGCCAGGGTGG + Intronic
1178723320 21:35029435-35029457 CAGAGCCAGCATAACAATGTTGG + Intronic
1178893056 21:36536091-36536113 CAGCTGCAGCCCAGCTCTGTGGG + Intronic
1179523328 21:41959461-41959483 CAGAGGCAGGGCAGCCATCTGGG - Intergenic
1179721267 21:43317228-43317250 CAGAGGGAGCACAGCCCTGCTGG + Intergenic
1179859778 21:44181266-44181288 CAGAGCCAGCCCAGCTGTCTGGG + Intergenic
1180966164 22:19788999-19789021 CAGGGGCAGCACTGCCTTGTGGG - Intronic
1181275446 22:21685041-21685063 CAGGGGCACCACAGCTCTGGGGG - Intronic
1181639144 22:24187709-24187731 AAGAGGCAGCCAAACTATGTGGG + Exonic
1181847432 22:25723011-25723033 CAGAGGCAGGGCAGTCATGTGGG - Exonic
1182785229 22:32902024-32902046 GGGAGGCTGCACAGCTTTGTTGG + Intronic
950296521 3:11837214-11837236 CAGAAGCAGCACATCACTGTTGG + Intronic
950485883 3:13273805-13273827 CAGAGCCAGCAGGGCCATGTGGG - Intergenic
952153657 3:30619862-30619884 CAGAGACAGCACAGGTAGCTTGG - Intronic
954397594 3:50301084-50301106 AGGAGACAGCACAGCTCTGTGGG + Intronic
956204682 3:66742951-66742973 CAGATTCAGCAGAGCTATGCTGG + Intergenic
957254451 3:77819080-77819102 TAGAGGAACCACAGCTGTGTGGG - Intergenic
959160559 3:102719426-102719448 CAGAGGAAGAAAAGATATGTTGG + Intergenic
960464960 3:117986314-117986336 CAGAGGCAGCACAGTAAAGAAGG + Intergenic
961427037 3:126856507-126856529 CAGTGGGAGCACAGCTAAGATGG - Intronic
961599081 3:128045120-128045142 CAGATGCAGCACAGATATGGAGG - Intergenic
963764842 3:149323965-149323987 CAGAAGCAGCTCTGCCATGTAGG + Intronic
964676704 3:159290414-159290436 CAGAGGAAGCATAGCAAAGTGGG + Intronic
965324646 3:167288832-167288854 CAAAGGCAGCAGTGCCATGTTGG - Intronic
966272370 3:178122561-178122583 CAGAAGCAGCACAGGTATTCTGG + Intergenic
967215174 3:187203613-187203635 CAGAGGGAGCACAGCAAAGCAGG + Intergenic
967436076 3:189447964-189447986 CAGAGGAAGTTCAGATATGTGGG + Intergenic
967882886 3:194314235-194314257 CAGAGCCAGCCCAGCCAGGTGGG - Intergenic
968359474 3:198137280-198137302 CAGAGGCCGCACAGCTGTCCTGG - Intergenic
969662254 4:8537127-8537149 CAGAGGCAGCACAGCTGCCTGGG + Intergenic
970606999 4:17690366-17690388 CAGAGGCAGCAGAGCCTTGGAGG + Intronic
973052075 4:45609456-45609478 CAGAGGGAGCACAGCCTGGTGGG - Intergenic
978688982 4:111483916-111483938 CCGAGACAGCACAGCTGTGGGGG - Intergenic
981336281 4:143572363-143572385 CAGAGCTAGCACAAATATGTTGG - Intergenic
984907191 4:184639554-184639576 CAGAGGCAGCATAGCAGAGTGGG - Intronic
985403122 4:189611728-189611750 CAGAGGCAGGATGGCTATTTTGG - Intergenic
985804311 5:2030206-2030228 CAGAGTATGCACAGTTATGTTGG + Intergenic
985820519 5:2157022-2157044 CATAGGCAGAGCAGCAATGTGGG - Intergenic
986260796 5:6144511-6144533 CAGAGACAGAACAGATGTGTAGG - Intergenic
986566317 5:9118770-9118792 CGGAGCCAGCCCAGCTGTGTAGG + Intronic
986762160 5:10889981-10890003 CAGAGGGATGACAGCTATGATGG + Intergenic
989513208 5:42312227-42312249 CAGAAGCAGCACAGCTTAGTGGG - Intergenic
991475138 5:67010926-67010948 CAGCAGCAGCGCAGCTATGATGG + Intronic
991500397 5:67270537-67270559 CAGAGGCAGTTCAGGTATGAGGG - Intergenic
993178453 5:84518569-84518591 CAGAGGCAGCATGGCTCAGTGGG + Intergenic
993467750 5:88269014-88269036 CAGGCGCAGCACAGGTACGTGGG + Intronic
994214648 5:97123919-97123941 CAGAGGCAGCATAGGTTTGTAGG + Intronic
995456034 5:112353503-112353525 CCCAGGCAGCACAGGTAGGTGGG + Intronic
996923617 5:128797495-128797517 CAGAGTGAGCACAGCCCTGTTGG - Intronic
997281445 5:132649961-132649983 GAGAGGCAACAGAGCTATATAGG + Intergenic
997361486 5:133298018-133298040 GAGAGGCAGCATAGCTTAGTAGG + Intronic
1000310968 5:160044371-160044393 CATAGGCAGAGCAGCAATGTGGG + Intronic
1001415160 5:171540511-171540533 CAGAGGCAGCACAGGGGAGTCGG - Intergenic
1003810491 6:9774099-9774121 CAGAGGCAGCACGTACATGTTGG - Intronic
1004248752 6:14004775-14004797 CAAAGGCAGGACAGCTAATTAGG + Intergenic
1004596309 6:17102878-17102900 CCGAGGCTGCACAGCTAATTTGG + Intronic
1007335898 6:41154633-41154655 CTGAGGGTGCACAGCTATGAAGG + Intergenic
1008720427 6:54343084-54343106 CAGATGAACTACAGCTATGTGGG - Intronic
1009437492 6:63635438-63635460 CCGAGCCAGCACAGATATTTGGG + Intergenic
1013637265 6:112041037-112041059 CAGAGACAGCACACCATTGTTGG - Intergenic
1015190839 6:130470523-130470545 CAGAAGCAGCACAATTATGGGGG + Intergenic
1017291868 6:152746361-152746383 CATAGACAGCACAGATATGCTGG + Intergenic
1019260525 7:79395-79417 CAGAGGCCGCACAGCTGTCCTGG + Intergenic
1020141787 7:5615686-5615708 AAGGGACAGCACAGCTCTGTGGG + Intergenic
1020382060 7:7557496-7557518 CAGAGGCAGCACCGCTGGGTGGG - Intergenic
1022255419 7:28651875-28651897 TAGAGGAAGCACCGCTAGGTAGG + Intronic
1022652461 7:32289860-32289882 GAGAAGCAGCACAGCCATTTGGG + Intronic
1024505914 7:50161201-50161223 CCGAGGAAGCACAGCTCTGCTGG - Intergenic
1030019286 7:105257110-105257132 CAAAGCCAGCACAGAAATGTAGG - Intronic
1030263944 7:107597003-107597025 CAGAGGAGGCACAGATATGCTGG + Intronic
1030713657 7:112784306-112784328 CATTGCCAGCACAACTATGTTGG - Exonic
1032442510 7:131952869-131952891 CTGAGGCAGCACAGCTTTAATGG - Intergenic
1032635525 7:133703708-133703730 CAAAGACAGAACAGCTGTGTTGG - Intronic
1032909074 7:136408262-136408284 CAGAGGCAACACAGCATGGTAGG - Intergenic
1034747602 7:153536876-153536898 CATAGGCAGCCAAGCTCTGTGGG - Intergenic
1035821566 8:2598320-2598342 CAGACCAAGCACAGGTATGTGGG + Intergenic
1036979445 8:13452879-13452901 TAGAGCCAGCACAGCTGTGGAGG - Intronic
1038668605 8:29563144-29563166 TAGAGTCTGCACAGGTATGTGGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1044587674 8:93883202-93883224 CATGGGCAGCAAAGCTATGTGGG - Intronic
1045064022 8:98429438-98429460 AAGAGGCAGCTCAGCAATGTGGG - Exonic
1046619302 8:116511608-116511630 CAGAGGTAGCAGAGCCTTGTTGG - Intergenic
1047220590 8:122915363-122915385 CACAGGCAGCAGAGTTAAGTGGG - Intronic
1047279663 8:123434153-123434175 CAGAGGCAGGAGAGCAATGCAGG - Intronic
1048320784 8:133398556-133398578 CTAGGGCAGCACAGCCATGTGGG + Intergenic
1048807072 8:138250808-138250830 CAGAGGCAGCCCTGATATGTGGG - Intronic
1054793252 9:69275451-69275473 CACAGCCAGCTCAGCCATGTGGG - Intergenic
1056534896 9:87518756-87518778 CAGTGTCTACACAGCTATGTGGG + Intronic
1056642430 9:88382850-88382872 CAGAGGCAGCTCTTCTGTGTTGG - Intergenic
1056649679 9:88447900-88447922 GATAGGCAGCACAGGTGTGTGGG - Intronic
1056889634 9:90478742-90478764 CAGAAGCAGCACAGCCATAAAGG + Intergenic
1057267649 9:93629838-93629860 CAGATGGAGCACAGCTGTGCAGG - Intronic
1058675515 9:107396745-107396767 CACAATCAGCACAGCTATTTAGG - Intergenic
1059625844 9:116065152-116065174 CAGAGGCAGGACAGCTATCTGGG + Intergenic
1061401177 9:130369353-130369375 CACAGGCAGGCCTGCTATGTGGG - Intronic
1062117165 9:134815663-134815685 CAGAGGCAGGCCAGCACTGTGGG - Intronic
1062386267 9:136312694-136312716 CACAGGCAGCACAGCCCTGCGGG - Intergenic
1062744162 9:138200994-138201016 CAGAGGCCGCACAGCTGTCCTGG - Intergenic
1185460135 X:329496-329518 CAGAGGCAGAAAAGCGATGGGGG - Intergenic
1188903652 X:35764671-35764693 CAAAGGAAGAACAGCTATGCAGG - Intergenic
1191695534 X:63985976-63985998 CAGAGGAAGCACAGCTCGGTGGG - Intergenic
1194078192 X:89423753-89423775 CAGATGCAGCCCCTCTATGTTGG + Intergenic
1194323466 X:92480941-92480963 CAGAGGCAGCATGGCTCTCTAGG + Intronic
1197413908 X:126151064-126151086 CAGAGTCACCACAGCTACTTGGG - Intergenic
1198267279 X:135021701-135021723 CAGTGGCAGCGCAGGTCTGTGGG + Exonic
1200430839 Y:3079299-3079321 CAGATGCAGCCCCTCTATGTTGG + Intergenic
1200631567 Y:5594107-5594129 CAGAGGCAGCATGGCTCTCTAGG + Intronic
1201448578 Y:14084648-14084670 CAGAGCCAGCATACATATGTTGG - Intergenic