ID: 927274865

View in Genome Browser
Species Human (GRCh38)
Location 2:21254199-21254221
Sequence TCTTTCTTTGAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927274860_927274865 11 Left 927274860 2:21254165-21254187 CCTATTAGCCAGAATGTACAAAA No data
Right 927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG No data
927274861_927274865 3 Left 927274861 2:21254173-21254195 CCAGAATGTACAAAAGCTGAAAA No data
Right 927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG No data
927274859_927274865 15 Left 927274859 2:21254161-21254183 CCTTCCTATTAGCCAGAATGTAC No data
Right 927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927274865 Original CRISPR TCTTTCTTTGAGAAGGTGGA GGG Intergenic
No off target data available for this crispr