ID: 927278890

View in Genome Browser
Species Human (GRCh38)
Location 2:21286475-21286497
Sequence CTGTAGTTGTCCAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927278885_927278890 13 Left 927278885 2:21286439-21286461 CCACAGTGGATAGTGCACTGTGA No data
Right 927278890 2:21286475-21286497 CTGTAGTTGTCCAAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927278890 Original CRISPR CTGTAGTTGTCCAAGGAAGA TGG Intergenic
No off target data available for this crispr