ID: 927279154

View in Genome Browser
Species Human (GRCh38)
Location 2:21288478-21288500
Sequence CAGAGTGAACAAAGGGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927279151_927279154 -9 Left 927279151 2:21288464-21288486 CCAGGAGGAGGGAACAGAGTGAA No data
Right 927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927279154 Original CRISPR CAGAGTGAACAAAGGGCTGT AGG Intergenic
No off target data available for this crispr