ID: 927288033

View in Genome Browser
Species Human (GRCh38)
Location 2:21377413-21377435
Sequence ACCAAAGGCAGGGAAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927288033_927288040 3 Left 927288033 2:21377413-21377435 CCACTCACTTCCCTGCCTTTGGT No data
Right 927288040 2:21377439-21377461 ATGGGTACTGGCTTCCCAGAAGG No data
927288033_927288042 10 Left 927288033 2:21377413-21377435 CCACTCACTTCCCTGCCTTTGGT No data
Right 927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG No data
927288033_927288038 -9 Left 927288033 2:21377413-21377435 CCACTCACTTCCCTGCCTTTGGT No data
Right 927288038 2:21377427-21377449 GCCTTTGGTTCTATGGGTACTGG No data
927288033_927288041 7 Left 927288033 2:21377413-21377435 CCACTCACTTCCCTGCCTTTGGT No data
Right 927288041 2:21377443-21377465 GTACTGGCTTCCCAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927288033 Original CRISPR ACCAAAGGCAGGGAAGTGAG TGG (reversed) Intergenic
No off target data available for this crispr