ID: 927288037

View in Genome Browser
Species Human (GRCh38)
Location 2:21377424-21377446
Sequence GTACCCATAGAACCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927288037_927288042 -1 Left 927288037 2:21377424-21377446 CCTGCCTTTGGTTCTATGGGTAC No data
Right 927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG No data
927288037_927288041 -4 Left 927288037 2:21377424-21377446 CCTGCCTTTGGTTCTATGGGTAC No data
Right 927288041 2:21377443-21377465 GTACTGGCTTCCCAGAAGGAAGG No data
927288037_927288040 -8 Left 927288037 2:21377424-21377446 CCTGCCTTTGGTTCTATGGGTAC No data
Right 927288040 2:21377439-21377461 ATGGGTACTGGCTTCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927288037 Original CRISPR GTACCCATAGAACCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr